Incidental Mutation 'R5708:Tmem38b'
ID452069
Institutional Source Beutler Lab
Gene Symbol Tmem38b
Ensembl Gene ENSMUSG00000028420
Gene Nametransmembrane protein 38B
Synonyms1600017F22Rik, TRIC-B, D4Ertd89e
MMRRC Submission 043333-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5708 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53826045-53862019 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to C at 53849051 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030127] [ENSMUST00000144167]
Predicted Effect probably null
Transcript: ENSMUST00000030127
SMART Domains Protein: ENSMUSP00000030127
Gene: ENSMUSG00000028420

DomainStartEndE-ValueType
Pfam:TRIC 36 227 4.1e-81 PFAM
low complexity region 249 256 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144167
SMART Domains Protein: ENSMUSP00000120304
Gene: ENSMUSG00000028420

DomainStartEndE-ValueType
Pfam:TRIC 9 164 3.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151206
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular monovalent cation channel that functions in maintenance of intracellular calcium release. Mutations in this gene may be associated with autosomal recessive osteogenesis. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous null newborn mice die of respiratory failure showing atelectasis, pulmonary congestion, impaired maturation of alveolar type II cells, reduced lamellar body formation, abnormal synthesis and secretion of surfactant phospholipids, and impaired Ca2+ release in alveolar type II cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,707 M158L probably benign Het
1700067K01Rik A G 8: 84,002,998 K101R probably benign Het
4933430I17Rik T C 4: 62,525,869 S18P probably benign Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aox4 G T 1: 58,245,873 A595S possibly damaging Het
Asxl2 T A 12: 3,500,603 S782T possibly damaging Het
C1s2 A T 6: 124,625,743 L503* probably null Het
C7 A G 15: 5,015,401 V385A possibly damaging Het
Cdh20 T C 1: 104,984,910 F630L probably damaging Het
Cdk14 A C 5: 5,266,036 probably benign Het
Cdkl4 T C 17: 80,539,522 I239M possibly damaging Het
Col11a1 A G 3: 114,097,094 N360S unknown Het
D630003M21Rik A G 2: 158,220,392 probably null Het
Dchs1 G A 7: 105,772,809 P135S probably damaging Het
Dpysl2 A G 14: 66,813,146 S421P probably benign Het
Edn1 A T 13: 42,303,667 M59L probably benign Het
EU599041 A G 7: 43,225,887 noncoding transcript Het
Fam196a C A 7: 134,918,796 V2F probably damaging Het
Furin A G 7: 80,397,855 probably benign Het
Gkn2 T C 6: 87,377,436 L94P probably damaging Het
Gmeb2 A T 2: 181,264,989 C117S probably damaging Het
Greb1 T A 12: 16,673,842 I1869F probably benign Het
Heg1 A G 16: 33,742,404 E1119G probably damaging Het
Hmgcs2 T A 3: 98,291,162 L127Q probably damaging Het
Kcnh6 A G 11: 106,020,256 R493G probably benign Het
Kcnj11 C T 7: 46,099,818 R27H probably benign Het
Klra14-ps A G 6: 130,157,788 noncoding transcript Het
Lgmn A T 12: 102,404,328 N114K possibly damaging Het
Lipg C T 18: 74,955,434 M148I possibly damaging Het
Megf8 G T 7: 25,334,597 R607L probably benign Het
Mks1 A G 11: 87,856,839 T183A probably benign Het
Mllt11 A G 3: 95,220,204 V85A probably benign Het
Mpo A T 11: 87,801,755 probably null Het
Muc4 A T 16: 32,754,769 probably benign Het
Myoz3 T C 18: 60,579,032 Y158C probably damaging Het
Olfr1287 A G 2: 111,450,009 R290G probably damaging Het
Olfr290 A G 7: 84,916,183 I135V possibly damaging Het
Olfr741 A T 14: 50,485,995 D179V probably damaging Het
Polq T A 16: 37,061,018 S902R probably damaging Het
Rarb T C 14: 16,548,545 T93A probably damaging Het
Rgs12 A G 5: 34,966,352 D493G probably benign Het
Sec31b T A 19: 44,523,144 D606V probably damaging Het
Setd2 T C 9: 110,548,823 F569L possibly damaging Het
Sil1 T C 18: 35,341,117 E149G probably benign Het
Spata13 T G 14: 60,692,003 S337A probably damaging Het
Srfbp1 T A 18: 52,488,946 L360M probably damaging Het
Tecta A T 9: 42,338,926 C1852S probably damaging Het
Tgfbr3l A G 8: 4,250,360 T208A probably damaging Het
Tnfrsf11a T A 1: 105,813,820 probably null Het
Tnik T A 3: 28,611,971 probably null Het
Tsc1 A T 2: 28,665,185 probably benign Het
Zfp930 T C 8: 69,226,461 V41A probably benign Het
Zscan18 A T 7: 12,774,456 D372E probably benign Het
Other mutations in Tmem38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Tmem38b APN 4 53849024 missense probably damaging 1.00
IGL01948:Tmem38b APN 4 53850530 missense probably damaging 0.97
IGL02383:Tmem38b APN 4 53854345 missense probably benign
IGL02619:Tmem38b APN 4 53848871 missense probably damaging 1.00
R0266:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R0849:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R1658:Tmem38b UTSW 4 53840713 missense probably benign
R3845:Tmem38b UTSW 4 53859905 missense probably benign 0.10
R3930:Tmem38b UTSW 4 53854398 missense probably damaging 1.00
R4012:Tmem38b UTSW 4 53854409 missense probably benign 0.01
R4233:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R4235:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R5388:Tmem38b UTSW 4 53859945 missense probably benign 0.04
R6083:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCATGTTCTTAGTGGTG -3'
(R):5'- TGGCTGATCACCAATACTGATGTAAG -3'

Sequencing Primer
(F):5'- AGGTATATTGTATTCTTTTGCCCTCG -3'
(R):5'- CCATCCCTGTAAGCAAAGA -3'
Posted On2017-01-03