Incidental Mutation 'R5708:Zscan18'
ID452077
Institutional Source Beutler Lab
Gene Symbol Zscan18
Ensembl Gene ENSMUSG00000070822
Gene Namezinc finger and SCAN domain containing 18
SynonymsEG232875
MMRRC Submission 043333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5708 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12768090-12803635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12774456 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 372 (D372E)
Ref Sequence ENSEMBL: ENSMUSP00000148239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046245] [ENSMUST00000210650] [ENSMUST00000211392]
Predicted Effect probably benign
Transcript: ENSMUST00000046245
AA Change: D372E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047088
Gene: ENSMUSG00000070822
AA Change: D372E

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 134 154 N/A INTRINSIC
internal_repeat_2 159 204 6.76e-5 PROSPERO
internal_repeat_1 197 221 2.66e-6 PROSPERO
low complexity region 225 256 N/A INTRINSIC
low complexity region 262 310 N/A INTRINSIC
low complexity region 312 335 N/A INTRINSIC
internal_repeat_1 353 377 2.66e-6 PROSPERO
SCAN 397 509 1.16e-37 SMART
ZnF_C2H2 776 798 2.24e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209869
Predicted Effect probably benign
Transcript: ENSMUST00000210650
AA Change: D372E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000210891
Predicted Effect probably benign
Transcript: ENSMUST00000211392
AA Change: D372E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211665
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,707 M158L probably benign Het
1700067K01Rik A G 8: 84,002,998 K101R probably benign Het
4933430I17Rik T C 4: 62,525,869 S18P probably benign Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aox4 G T 1: 58,245,873 A595S possibly damaging Het
Asxl2 T A 12: 3,500,603 S782T possibly damaging Het
C1s2 A T 6: 124,625,743 L503* probably null Het
C7 A G 15: 5,015,401 V385A possibly damaging Het
Cdh20 T C 1: 104,984,910 F630L probably damaging Het
Cdk14 A C 5: 5,266,036 probably benign Het
Cdkl4 T C 17: 80,539,522 I239M possibly damaging Het
Col11a1 A G 3: 114,097,094 N360S unknown Het
D630003M21Rik A G 2: 158,220,392 probably null Het
Dchs1 G A 7: 105,772,809 P135S probably damaging Het
Dpysl2 A G 14: 66,813,146 S421P probably benign Het
Edn1 A T 13: 42,303,667 M59L probably benign Het
EU599041 A G 7: 43,225,887 noncoding transcript Het
Fam196a C A 7: 134,918,796 V2F probably damaging Het
Furin A G 7: 80,397,855 probably benign Het
Gkn2 T C 6: 87,377,436 L94P probably damaging Het
Gmeb2 A T 2: 181,264,989 C117S probably damaging Het
Greb1 T A 12: 16,673,842 I1869F probably benign Het
Heg1 A G 16: 33,742,404 E1119G probably damaging Het
Hmgcs2 T A 3: 98,291,162 L127Q probably damaging Het
Kcnh6 A G 11: 106,020,256 R493G probably benign Het
Kcnj11 C T 7: 46,099,818 R27H probably benign Het
Klra14-ps A G 6: 130,157,788 noncoding transcript Het
Lgmn A T 12: 102,404,328 N114K possibly damaging Het
Lipg C T 18: 74,955,434 M148I possibly damaging Het
Megf8 G T 7: 25,334,597 R607L probably benign Het
Mks1 A G 11: 87,856,839 T183A probably benign Het
Mllt11 A G 3: 95,220,204 V85A probably benign Het
Mpo A T 11: 87,801,755 probably null Het
Muc4 A T 16: 32,754,769 probably benign Het
Myoz3 T C 18: 60,579,032 Y158C probably damaging Het
Olfr1287 A G 2: 111,450,009 R290G probably damaging Het
Olfr290 A G 7: 84,916,183 I135V possibly damaging Het
Olfr741 A T 14: 50,485,995 D179V probably damaging Het
Polq T A 16: 37,061,018 S902R probably damaging Het
Rarb T C 14: 16,548,545 T93A probably damaging Het
Rgs12 A G 5: 34,966,352 D493G probably benign Het
Sec31b T A 19: 44,523,144 D606V probably damaging Het
Setd2 T C 9: 110,548,823 F569L possibly damaging Het
Sil1 T C 18: 35,341,117 E149G probably benign Het
Spata13 T G 14: 60,692,003 S337A probably damaging Het
Srfbp1 T A 18: 52,488,946 L360M probably damaging Het
Tecta A T 9: 42,338,926 C1852S probably damaging Het
Tgfbr3l A G 8: 4,250,360 T208A probably damaging Het
Tmem38b G C 4: 53,849,051 probably null Het
Tnfrsf11a T A 1: 105,813,820 probably null Het
Tnik T A 3: 28,611,971 probably null Het
Tsc1 A T 2: 28,665,185 probably benign Het
Zfp930 T C 8: 69,226,461 V41A probably benign Het
Other mutations in Zscan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Zscan18 APN 7 12775348 unclassified probably benign
IGL02152:Zscan18 APN 7 12775296 unclassified probably benign
IGL02236:Zscan18 APN 7 12769324 missense probably benign 0.02
IGL02591:Zscan18 APN 7 12775279 unclassified probably benign
IGL02619:Zscan18 APN 7 12774866 unclassified probably benign
IGL02711:Zscan18 APN 7 12775117 unclassified probably benign
IGL03397:Zscan18 APN 7 12773561 missense probably damaging 0.97
R0014:Zscan18 UTSW 7 12769417 missense possibly damaging 0.48
R0465:Zscan18 UTSW 7 12775486 unclassified probably benign
R0548:Zscan18 UTSW 7 12774176 missense probably damaging 1.00
R1506:Zscan18 UTSW 7 12774202 missense probably damaging 1.00
R1725:Zscan18 UTSW 7 12770857 missense probably damaging 1.00
R2323:Zscan18 UTSW 7 12775459 unclassified probably benign
R5034:Zscan18 UTSW 7 12774145 missense probably damaging 1.00
R5180:Zscan18 UTSW 7 12775289 unclassified probably benign
R5579:Zscan18 UTSW 7 12775381 unclassified probably benign
R5635:Zscan18 UTSW 7 12770864 missense probably benign 0.00
R6088:Zscan18 UTSW 7 12775198 unclassified probably benign
R6320:Zscan18 UTSW 7 12775220 unclassified probably benign
R7048:Zscan18 UTSW 7 12774744 unclassified probably benign
R7610:Zscan18 UTSW 7 12769310 missense probably damaging 0.98
R7683:Zscan18 UTSW 7 12769605 nonsense probably null
R8287:Zscan18 UTSW 7 12775371 missense unknown
RF055:Zscan18 UTSW 7 12774425 small deletion probably benign
Z1088:Zscan18 UTSW 7 12775067 missense probably benign 0.18
Z1088:Zscan18 UTSW 7 12775093 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCCAGGATCTGCTCTTTGG -3'
(R):5'- GCCAGAAGGATCAATGCAAC -3'

Sequencing Primer
(F):5'- TCTTTGGAGCAGGCCTCG -3'
(R):5'- TCAATGCAACCAACAGGAGG -3'
Posted On2017-01-03