Mutagenetix > Incidental Mutations

Incidental Mutation 'R5708:Greb1'

452097

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

043333-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5708 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16673842 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1869 (I1869F)

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

Predicted Effect

probably benign
Transcript: ENSMUST00000048064
AA Change: I1869F

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: I1869F

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159120
AA Change: I1841F

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: I1841F

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160851

Predicted Effect

probably benign
Transcript: ENSMUST00000162112
AA Change: I1869F

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: I1869F

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223113

Meta Mutation Damage Score

0.0748

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,737,707	M158L	probably benign	Het
1700067K01Rik	A	G	8: 84,002,998	K101R	probably benign	Het
4933430I17Rik	T	C	4: 62,525,869	S18P	probably benign	Het
Adgb	C	T	10: 10,391,757	V940I	probably damaging	Het
Aox4	G	T	1: 58,245,873	A595S	possibly damaging	Het
Asxl2	T	A	12: 3,500,603	S782T	possibly damaging	Het
C1s2	A	T	6: 124,625,743	L503*	probably null	Het
C7	A	G	15: 5,015,401	V385A	possibly damaging	Het
Cdh20	T	C	1: 104,984,910	F630L	probably damaging	Het
Cdk14	A	C	5: 5,266,036		probably benign	Het
Cdkl4	T	C	17: 80,539,522	I239M	possibly damaging	Het
Col11a1	A	G	3: 114,097,094	N360S	unknown	Het
D630003M21Rik	A	G	2: 158,220,392		probably null	Het
Dchs1	G	A	7: 105,772,809	P135S	probably damaging	Het
Dpysl2	A	G	14: 66,813,146	S421P	probably benign	Het
Edn1	A	T	13: 42,303,667	M59L	probably benign	Het
EU599041	A	G	7: 43,225,887		noncoding transcript	Het
Fam196a	C	A	7: 134,918,796	V2F	probably damaging	Het
Furin	A	G	7: 80,397,855		probably benign	Het
Gkn2	T	C	6: 87,377,436	L94P	probably damaging	Het
Gmeb2	A	T	2: 181,264,989	C117S	probably damaging	Het
Heg1	A	G	16: 33,742,404	E1119G	probably damaging	Het
Hmgcs2	T	A	3: 98,291,162	L127Q	probably damaging	Het
Kcnh6	A	G	11: 106,020,256	R493G	probably benign	Het
Kcnj11	C	T	7: 46,099,818	R27H	probably benign	Het
Klra14-ps	A	G	6: 130,157,788		noncoding transcript	Het
Lgmn	A	T	12: 102,404,328	N114K	possibly damaging	Het
Lipg	C	T	18: 74,955,434	M148I	possibly damaging	Het
Megf8	G	T	7: 25,334,597	R607L	probably benign	Het
Mks1	A	G	11: 87,856,839	T183A	probably benign	Het
Mllt11	A	G	3: 95,220,204	V85A	probably benign	Het
Mpo	A	T	11: 87,801,755		probably null	Het
Muc4	A	T	16: 32,754,769		probably benign	Het
Myoz3	T	C	18: 60,579,032	Y158C	probably damaging	Het
Olfr1287	A	G	2: 111,450,009	R290G	probably damaging	Het
Olfr290	A	G	7: 84,916,183	I135V	possibly damaging	Het
Olfr741	A	T	14: 50,485,995	D179V	probably damaging	Het
Polq	T	A	16: 37,061,018	S902R	probably damaging	Het
Rarb	T	C	14: 16,548,545	T93A	probably damaging	Het
Rgs12	A	G	5: 34,966,352	D493G	probably benign	Het
Sec31b	T	A	19: 44,523,144	D606V	probably damaging	Het
Setd2	T	C	9: 110,548,823	F569L	possibly damaging	Het
Sil1	T	C	18: 35,341,117	E149G	probably benign	Het
Spata13	T	G	14: 60,692,003	S337A	probably damaging	Het
Srfbp1	T	A	18: 52,488,946	L360M	probably damaging	Het
Tecta	A	T	9: 42,338,926	C1852S	probably damaging	Het
Tgfbr3l	A	G	8: 4,250,360	T208A	probably damaging	Het
Tmem38b	G	C	4: 53,849,051		probably null	Het
Tnfrsf11a	T	A	1: 105,813,820		probably null	Het
Tnik	T	A	3: 28,611,971		probably null	Het
Tsc1	A	T	2: 28,665,185		probably benign	Het
Zfp930	T	C	8: 69,226,461	V41A	probably benign	Het
Zscan18	A	T	7: 12,774,456	D372E	probably benign	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCTTCGGTTTACCCCATG -3'
(R):5'- TCTGGAAACATAATGGCCATCTC -3'

Sequencing Primer
(F):5'- TCGGTTTACCCCATGGACAAG -3'
(R):5'- TGGAAACATAATGGCCATCTCTATCC -3'

Posted On

2017-01-03