Incidental Mutation 'R0551:Sorbs1'
ID 45210
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Name sorbin and SH3 domain containing 1
Synonyms c-Cbl-associated protein, Ponsin, CAP, 2310065E01Rik, 9530001P15Rik, Sh3d5
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.751) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 40283197-40502223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40300260 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 567 (E567D)
Ref Sequence ENSEMBL: ENSMUSP00000153489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224247] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000226047] [ENSMUST00000225786]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000099466
AA Change: E612D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006
AA Change: E612D

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099467
AA Change: E810D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: E810D

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165212
AA Change: E596D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006
AA Change: E596D

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165469
AA Change: E586D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006
AA Change: E586D

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224227
Predicted Effect probably damaging
Transcript: ENSMUST00000224247
AA Change: E556D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224667
AA Change: E1162D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225148
AA Change: E556D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225153
AA Change: E810D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226047
AA Change: E567D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225786
AA Change: E586D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000225710
Meta Mutation Damage Score 0.2936 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40,306,473 (GRCm39) missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40,332,795 (GRCm39) splice site probably null
IGL00788:Sorbs1 APN 19 40,325,487 (GRCm39) splice site probably benign
IGL00943:Sorbs1 APN 19 40,283,484 (GRCm39) utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40,338,422 (GRCm39) missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40,365,091 (GRCm39) missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40,306,460 (GRCm39) splice site probably benign
IGL02159:Sorbs1 APN 19 40,316,040 (GRCm39) missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40,302,841 (GRCm39) missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40,315,991 (GRCm39) missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40,353,577 (GRCm39) missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40,303,125 (GRCm39) missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40,365,348 (GRCm39) missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40,365,187 (GRCm39) missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40,302,820 (GRCm39) missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40,351,706 (GRCm39) missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40,332,858 (GRCm39) missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40,362,009 (GRCm39) missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0306:Sorbs1 UTSW 19 40,332,855 (GRCm39) missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40,338,392 (GRCm39) missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40,351,706 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40,381,904 (GRCm39) missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40,353,472 (GRCm39) splice site probably null
R2148:Sorbs1 UTSW 19 40,365,268 (GRCm39) missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40,285,075 (GRCm39) missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40,361,959 (GRCm39) missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40,362,015 (GRCm39) missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40,302,887 (GRCm39) missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40,384,189 (GRCm39) missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40,300,294 (GRCm39) missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40,361,962 (GRCm39) missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40,328,491 (GRCm39) nonsense probably null
R4912:Sorbs1 UTSW 19 40,300,171 (GRCm39) missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40,329,151 (GRCm39) missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40,310,334 (GRCm39) missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40,365,433 (GRCm39) missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40,365,325 (GRCm39) missense probably benign
R5871:Sorbs1 UTSW 19 40,387,027 (GRCm39) missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40,313,216 (GRCm39) missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40,303,101 (GRCm39) missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40,310,263 (GRCm39) missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40,365,426 (GRCm39) critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40,314,496 (GRCm39) missense probably benign
R6646:Sorbs1 UTSW 19 40,313,993 (GRCm39) missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40,315,991 (GRCm39) missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6850:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6878:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6879:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6880:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6908:Sorbs1 UTSW 19 40,340,776 (GRCm39) missense probably damaging 1.00
R6980:Sorbs1 UTSW 19 40,316,060 (GRCm39) nonsense probably null
R7040:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7041:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7110:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7122:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7170:Sorbs1 UTSW 19 40,314,573 (GRCm39) nonsense probably null
R7180:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7185:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7187:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7254:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7255:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7401:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7595:Sorbs1 UTSW 19 40,303,097 (GRCm39) missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7876:Sorbs1 UTSW 19 40,285,032 (GRCm39) missense probably damaging 1.00
R7894:Sorbs1 UTSW 19 40,316,020 (GRCm39) missense probably benign 0.02
R7986:Sorbs1 UTSW 19 40,353,449 (GRCm39) missense probably damaging 0.99
R8031:Sorbs1 UTSW 19 40,314,933 (GRCm39) missense probably benign 0.17
R8082:Sorbs1 UTSW 19 40,353,527 (GRCm39) missense probably benign 0.08
R8282:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8283:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8446:Sorbs1 UTSW 19 40,314,602 (GRCm39) missense probably benign
R8526:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8527:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8528:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8539:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8540:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8542:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8543:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8544:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8545:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8684:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8699:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8702:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8752:Sorbs1 UTSW 19 40,349,872 (GRCm39) critical splice donor site probably null
R8937:Sorbs1 UTSW 19 40,362,006 (GRCm39) missense probably benign 0.02
R8956:Sorbs1 UTSW 19 40,351,660 (GRCm39) missense probably damaging 1.00
R8960:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9175:Sorbs1 UTSW 19 40,315,018 (GRCm39) missense probably damaging 1.00
R9208:Sorbs1 UTSW 19 40,353,462 (GRCm39) start gained probably benign
R9211:Sorbs1 UTSW 19 40,332,798 (GRCm39) critical splice donor site probably null
R9371:Sorbs1 UTSW 19 40,315,324 (GRCm39) missense probably damaging 0.98
R9374:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9377:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9551:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9552:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9686:Sorbs1 UTSW 19 40,381,954 (GRCm39) missense probably damaging 1.00
Z1177:Sorbs1 UTSW 19 40,315,339 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGAGCATGGAAGAGTAGTCCCAG -3'
(R):5'- ATCCAAGGCCAATAGAGATGGCCC -3'

Sequencing Primer
(F):5'- TAGTCCCAGAAGGGCTGTG -3'
(R):5'- CAATAGAGATGGCCCTCCTGAG -3'
Posted On 2013-06-11