Incidental Mutation 'R5709:Car14'
ID452124
Institutional Source Beutler Lab
Gene Symbol Car14
Ensembl Gene ENSMUSG00000038526
Gene Namecarbonic anhydrase 14
SynonymsCA XIV
MMRRC Submission 043184-MU
Accession Numbers

Genbank: NM_011797; MGI: 1344341

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5709 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95897768-95904691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95898988 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 284 (L284Q)
Ref Sequence ENSEMBL: ENSMUSP00000036983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000056710] [ENSMUST00000147962] [ENSMUST00000197081]
PDB Structure
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV [X-RAY DIFFRACTION]
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV in Complex with Acetazolamide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015894
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036181
AA Change: L284Q

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526
AA Change: L284Q

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056710
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126722
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149202
Predicted Effect probably benign
Transcript: ENSMUST00000197081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197232
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XIV is predicted to be a type I membrane protein and shares highest sequence similarity with the other transmembrane CA isoform, CA XII; however, they have different patterns of tissue-specific expression and thus may play different physiologic roles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and display normal growth, health and fertility. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armt1 T G 10: 4,434,903 H39Q probably damaging Het
Ccdc154 T C 17: 25,170,144 S437P probably damaging Het
Dpp9 C T 17: 56,189,393 V772I probably benign Het
Gm973 A T 1: 59,552,555 K366I possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Iglc2 T C 16: 19,198,634 T74A probably benign Het
Inhbb T A 1: 119,417,530 Y343F probably damaging Het
Krt13 C T 11: 100,117,643 G423R unknown Het
Lama3 T G 18: 12,539,799 M2483R probably damaging Het
Lrrc66 T C 5: 73,608,863 E279G probably benign Het
Matr3 A G 18: 35,581,962 E205G probably damaging Het
Mkks G A 2: 136,880,736 T167I probably benign Het
Mmp24 T A 2: 155,792,542 Y61N probably damaging Het
Nfkb2 A G 19: 46,310,521 T665A probably damaging Het
Nlrp3 G A 11: 59,555,748 W773* probably null Het
Olfr976 A T 9: 39,956,563 V136E probably damaging Het
Prol1 A T 5: 88,327,852 R34* probably null Het
Rcn1 T C 2: 105,394,783 Y109C probably damaging Het
Rint1 T G 5: 23,815,833 V618G probably damaging Het
Rtkn2 T A 10: 68,001,970 N117K probably benign Het
Sbno2 T C 10: 80,086,337 M1V probably null Het
Shb T C 4: 45,458,327 E279G probably damaging Het
Smarcad1 A G 6: 65,074,762 D293G probably benign Het
Sohlh2 T C 3: 55,192,302 L165P probably benign Het
Spred2 T C 11: 20,021,415 C428R probably damaging Het
Stra8 A T 6: 34,927,762 D13V possibly damaging Het
Tdrd12 A G 7: 35,476,053 V976A probably damaging Het
Ttn A G 2: 76,943,387 S2297P unknown Het
Ttn A G 2: 76,894,658 probably null Het
Usp1 A G 4: 98,931,123 D274G probably damaging Het
Vmn1r4 A G 6: 56,956,619 K36R probably benign Het
Zfp386 T A 12: 116,059,685 I306N probably benign Het
Zmpste24 T C 4: 121,065,878 D380G probably benign Het
Other mutations in Car14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Car14 APN 3 95898816 missense probably damaging 1.00
IGL01287:Car14 APN 3 95899559 missense possibly damaging 0.68
IGL01900:Car14 APN 3 95901221 missense probably benign 0.00
IGL02402:Car14 APN 3 95899558 missense possibly damaging 0.92
IGL03152:Car14 APN 3 95898845 missense probably damaging 1.00
R0109:Car14 UTSW 3 95899451 missense probably benign 0.00
R1729:Car14 UTSW 3 95901248 missense possibly damaging 0.90
R4521:Car14 UTSW 3 95904378 utr 5 prime probably benign
R4776:Car14 UTSW 3 95898873 missense probably benign 0.30
R6358:Car14 UTSW 3 95898175 missense possibly damaging 0.93
R6895:Car14 UTSW 3 95898160 missense probably benign
R7217:Car14 UTSW 3 95899317 missense probably damaging 1.00
R7648:Car14 UTSW 3 95898195 missense probably benign 0.01
R7763:Car14 UTSW 3 95904372 start codon destroyed probably null 0.01
X0026:Car14 UTSW 3 95899209 unclassified probably benign
X0064:Car14 UTSW 3 95901099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAATAGAAAGTAGGATCTCACC -3'
(R):5'- AGGCGTGAAATAGTGAACCCC -3'

Sequencing Primer
(F):5'- TTTTGAGCGATGAAATAAACAGCCAG -3'
(R):5'- TAGTGAACCCCTGGGAAGG -3'
Posted On2017-01-03