Mutagenetix > Incidental Mutation

Incidental Mutation 'R0552:Tlr5'

45214

Institutional Source

Beutler Lab

Gene Symbol

Tlr5

Ensembl Gene

ENSMUSG00000079164

Gene Name

toll-like receptor 5

Synonyms

MMRRC Submission

038744-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R0552 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

182954788-182976044 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 182975696 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110997
AA Change: E855G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: E855G

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	3.11e-2	SMART
LRR	159	183	5.56e0	SMART
LRR	184	207	1.97e2	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	7.05e-1	SMART
LRR	350	373	2.92e1	SMART
LRR	374	397	2.54e1	SMART
LRR	398	418	1.29e2	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	1.06e-4	SMART
LRR	540	563	6.13e-1	SMART
LRR	564	585	2.21e2	SMART
LRRCT	594	645	7.01e-6	SMART
low complexity region	657	676	N/A	INTRINSIC
TIR	707	852	3.89e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191820
AA Change: E841G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: E841G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
LRR_TYP	95	118	1.3e-4	SMART
LRR	145	169	2.3e-2	SMART
LRR	170	193	8.2e-1	SMART
low complexity region	248	261	N/A	INTRINSIC
LRR	312	335	2.9e-3	SMART
LRR	336	359	1.2e-1	SMART
LRR	360	383	1.1e-1	SMART
LRR	384	404	5.4e-1	SMART
low complexity region	427	442	N/A	INTRINSIC
LRR_TYP	502	525	4.5e-7	SMART
LRR	526	549	2.5e-3	SMART
LRR	550	571	9.4e-1	SMART
LRRCT	580	631	3.4e-8	SMART
transmembrane domain	642	664	N/A	INTRINSIC
TIR	693	838	2.5e-27	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000193687

SMART Domains

Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	1.3e-4	SMART
LRR	159	183	2.3e-2	SMART
LRR	184	207	8.2e-1	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	2.9e-3	SMART
LRR	350	373	1.2e-1	SMART
LRR	374	397	1.1e-1	SMART
LRR	398	418	5.4e-1	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	4.5e-7	SMART
LRR	540	563	2.5e-3	SMART
LRR	564	585	9.4e-1	SMART
LRRCT	594	645	3.4e-8	SMART
transmembrane domain	656	678	N/A	INTRINSIC
TIR	707	852	2.5e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195603

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam9	A	T	8: 24,963,010	N760K	probably benign	Het
Akr1b10	A	G	6: 34,392,985	T216A	possibly damaging	Het
Arsj	A	G	3: 126,439,344	R580G	probably benign	Het
C9	A	T	15: 6,445,437	I26F	probably damaging	Het
Cacna2d1	A	G	5: 16,328,043	E578G	probably damaging	Het
Clca4b	C	T	3: 144,916,775	V510I	probably benign	Het
Dab2	C	T	15: 6,435,414	T561I	possibly damaging	Het
E430018J23Rik	A	T	7: 127,392,332	I161N	possibly damaging	Het
Gm4737	T	A	16: 46,154,592	T141S	probably benign	Het
Golga5	A	T	12: 102,484,493	E12D	possibly damaging	Het
Hsd17b12	A	T	2: 94,043,935	F208I	probably damaging	Het
Inf2	A	G	12: 112,612,574		probably benign	Het
Kcnh3	T	A	15: 99,229,456	W378R	probably damaging	Het
Klhdc8b	G	C	9: 108,449,223	R158G	possibly damaging	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Lcn3	T	C	2: 25,766,409		probably null	Het
Mppe1	A	G	18: 67,237,348		probably null	Het
Muc20	G	A	16: 32,793,930	A359V	probably damaging	Het
Myh14	T	C	7: 44,613,681	D1765G	probably damaging	Het
Olfr1257	C	T	2: 89,880,891	Q22*	probably null	Het
Olfr418	T	C	1: 173,270,805	M210T	probably benign	Het
Olfr482	A	G	7: 108,094,778	M264T	probably benign	Het
Pbrm1	T	A	14: 31,035,959	L182Q	probably damaging	Het
Pde8a	A	G	7: 81,317,347	N412S	probably benign	Het
Phyh	A	G	2: 4,936,101	T271A	probably damaging	Het
Pkhd1l1	T	C	15: 44,489,546	S258P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Pyroxd1	A	G	6: 142,345,737	E2G	probably benign	Het
Ralgapa1	G	T	12: 55,676,765	Q2115K	probably benign	Het
Rufy3	A	G	5: 88,584,270	E44G	possibly damaging	Het
Slit2	A	T	5: 48,238,379	N712I	probably damaging	Het
Sptbn1	A	G	11: 30,145,985	M303T	possibly damaging	Het
Ssbp4	A	G	8: 70,599,859	I154T	probably benign	Het
Syne2	A	G	12: 75,931,004	K1409E	probably benign	Het
Tfap2b	T	C	1: 19,234,225	Y420H	probably damaging	Het
Tmprss15	C	T	16: 79,024,749		probably null	Het
Tns1	A	T	1: 73,920,563	I418N	probably damaging	Het
Txlna	A	T	4: 129,629,191	V452D	probably benign	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zfp563	A	T	17: 33,104,685	S85C	possibly damaging	Het

Other mutations in Tlr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Tlr5	APN	1	182973829	missense	probably benign
IGL00940:Tlr5	APN	1	182974196	missense	possibly damaging	0.84
IGL01302:Tlr5	APN	1	182974748	missense	probably benign	0.00
IGL01480:Tlr5	APN	1	182973499	missense	probably benign	0.09
IGL01717:Tlr5	APN	1	182975398	missense	probably damaging	1.00
IGL01896:Tlr5	APN	1	182974879	missense	possibly damaging	0.64
IGL02083:Tlr5	APN	1	182973884	missense	possibly damaging	0.91
IGL02135:Tlr5	APN	1	182973254	missense	possibly damaging	0.82
R0464:Tlr5	UTSW	1	182973710	missense	probably benign	0.01
R0556:Tlr5	UTSW	1	182974151	missense	probably damaging	1.00
R0639:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R0670:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R1014:Tlr5	UTSW	1	182975677	missense	probably benign	0.00
R1125:Tlr5	UTSW	1	182973892	missense	probably benign	0.00
R1563:Tlr5	UTSW	1	182975010	missense	probably benign	0.09
R1775:Tlr5	UTSW	1	182973722	missense	probably damaging	0.99
R1793:Tlr5	UTSW	1	182972447	missense	probably benign	0.00
R1991:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R1992:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R2114:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2116:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2225:Tlr5	UTSW	1	182972376	start gained	probably benign
R2265:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2266:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2268:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2882:Tlr5	UTSW	1	182973893	missense	probably damaging	1.00
R3695:Tlr5	UTSW	1	182975347	missense	probably damaging	1.00
R3747:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R3749:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R4084:Tlr5	UTSW	1	182974848	missense	possibly damaging	0.60
R4794:Tlr5	UTSW	1	182973896	missense	probably benign	0.00
R4895:Tlr5	UTSW	1	182974199	missense	probably damaging	1.00
R4964:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R4966:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R5496:Tlr5	UTSW	1	182973632	missense	probably damaging	1.00
R6056:Tlr5	UTSW	1	182974038	missense	possibly damaging	0.76
R6715:Tlr5	UTSW	1	182972659	intron	probably benign
R6825:Tlr5	UTSW	1	182973044	intron	probably benign
R6961:Tlr5	UTSW	1	182973511	nonsense	probably null
R7135:Tlr5	UTSW	1	182975523	missense	possibly damaging	0.87
R7232:Tlr5	UTSW	1	182973499	missense	probably benign	0.09
R7255:Tlr5	UTSW	1	182974316	missense	probably damaging	1.00
R7257:Tlr5	UTSW	1	182974233	nonsense	probably null
R8887:Tlr5	UTSW	1	182973767	missense	probably benign	0.07
R9116:Tlr5	UTSW	1	182974595	missense	probably benign
R9224:Tlr5	UTSW	1	182975128	missense	probably benign	0.10
R9284:Tlr5	UTSW	1	182973812	missense	probably benign	0.00
Z1177:Tlr5	UTSW	1	182973817	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGCAGACACTTCCTGAAGGATGG -3'
(R):5'- GAGGCAGCTTTCTGGACCTCTTAC -3'

Sequencing Primer
(F):5'- AGTCTGTCTGACCTCAAGAGC -3'
(R):5'- TGAGACAAAGCTCCCTGTTG -3'

Posted On

2013-06-11