Incidental Mutation 'R0552:Phyh'
ID45215
Institutional Source Beutler Lab
Gene Symbol Phyh
Ensembl Gene ENSMUSG00000026664
Gene Namephytanoyl-CoA hydroxylase
SynonymsLnap1
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location4919019-4938730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4936101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 271 (T271A)
Ref Sequence ENSEMBL: ENSMUSP00000027975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027975]
Predicted Effect probably damaging
Transcript: ENSMUST00000027975
AA Change: T271A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027975
Gene: ENSMUSG00000026664
AA Change: T271A

DomainStartEndE-ValueType
Pfam:PhyH 61 277 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128738
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high phytol diet, mice homozygous for a null allele exhibit hepatic lipidosis and steatosis, ataxia, peripheral neuropathy and loss of spermatogonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Phyh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Phyh APN 2 4930793 missense probably null 1.00
R1624:Phyh UTSW 2 4925683 missense probably benign 0.11
R1656:Phyh UTSW 2 4938353 missense probably damaging 0.97
R1721:Phyh UTSW 2 4937809 missense probably null 0.24
R3161:Phyh UTSW 2 4937671 splice site probably benign
R5353:Phyh UTSW 2 4942201 unclassified probably benign
R5907:Phyh UTSW 2 4930651 intron probably null
R6093:Phyh UTSW 2 4919085 missense possibly damaging 0.51
R6188:Phyh UTSW 2 4927490 missense probably damaging 0.96
R6394:Phyh UTSW 2 4936003 missense probably benign 0.02
R7316:Phyh UTSW 2 4936044 nonsense probably null
X0060:Phyh UTSW 2 4938350 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCTGCTGCATTACTGATGAAGTC -3'
(R):5'- ACTTGCTTCCTGTTGTGCCTTAGAG -3'

Sequencing Primer
(F):5'- CATTACTGATGAAGTCTTGTTCACGG -3'
(R):5'- GGACACTGCTGTTGAGAACTC -3'
Posted On2013-06-11