Incidental Mutation 'R5710:Tbl1xr1'
List |< first << previous [record 34 of 41] next >> last >|
ID452157
Institutional Source Beutler Lab
Gene Symbol Tbl1xr1
Ensembl Gene ENSMUSG00000027630
Gene Nametransducin (beta)-like 1X-linked receptor 1
Synonyms8030499H02Rik, Ira1, DC42, A630076E03Rik, C21, C230089I12Rik, TBLR1
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location22076652-22216594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22210414 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 511 (D511G)
Ref Sequence ENSEMBL: ENSMUSP00000144436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063988] [ENSMUST00000192328] [ENSMUST00000193734] [ENSMUST00000201509] [ENSMUST00000202747]
Predicted Effect probably damaging
Transcript: ENSMUST00000063988
AA Change: D511G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067164
Gene: ENSMUSG00000027630
AA Change: D511G

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192328
AA Change: D511G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141363
Gene: ENSMUSG00000027630
AA Change: D511G

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193734
AA Change: D511G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142184
Gene: ENSMUSG00000027630
AA Change: D511G

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000201467
AA Change: D63G
Predicted Effect probably benign
Transcript: ENSMUST00000201509
SMART Domains Protein: ENSMUSP00000144547
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 3.2e-10 SMART
WD40 208 253 6.2e-7 SMART
WD40 255 294 2.9e-9 SMART
WD40 297 335 4.5e-5 SMART
WD40 338 377 5.9e-15 SMART
WD40 380 428 1.1e-11 SMART
WD40 431 470 2.1e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202747
AA Change: D511G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144436
Gene: ENSMUSG00000027630
AA Change: D511G

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WD40 repeat-containing gene family and shares sequence similarity with transducin (beta)-like 1X-linked (TBL1X). The protein encoded by this gene is thought to be a component of both nuclear receptor corepressor (N-CoR) and histone deacetylase 3 (HDAC 3) complexes, and is required for transcriptional activation by a variety of transcription factors. Mutations in these gene have been associated with some autism spectrum disorders, and one finding suggests that haploinsufficiency of this gene may be a cause of intellectual disability with dysmorphism. Mutations in this gene as well as recurrent translocations involving this gene have also been observed in some tumors. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in adipose tissue exhibit increased body weight, and total body fat and increased susceptibility to diet-induced obesity and impaired glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Tbl1xr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tbl1xr1 APN 3 22192268 critical splice donor site probably null
IGL00825:Tbl1xr1 APN 3 22189786 splice site probably null
IGL01622:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01623:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01717:Tbl1xr1 APN 3 22193171 splice site probably benign
IGL02421:Tbl1xr1 APN 3 22203163 missense probably damaging 0.99
IGL03117:Tbl1xr1 APN 3 22203159 nonsense probably null
R0076:Tbl1xr1 UTSW 3 22189785 missense probably benign 0.06
R0601:Tbl1xr1 UTSW 3 22179319 splice site probably benign
R0629:Tbl1xr1 UTSW 3 22210401 missense probably benign 0.41
R0654:Tbl1xr1 UTSW 3 22203994 critical splice donor site probably null
R0811:Tbl1xr1 UTSW 3 22200587 splice site probably benign
R1457:Tbl1xr1 UTSW 3 22193169 critical splice donor site probably null
R1496:Tbl1xr1 UTSW 3 22190951 missense possibly damaging 0.68
R1914:Tbl1xr1 UTSW 3 22190910 splice site probably benign
R2680:Tbl1xr1 UTSW 3 22191451 missense possibly damaging 0.76
R3929:Tbl1xr1 UTSW 3 22189768 missense probably damaging 1.00
R4193:Tbl1xr1 UTSW 3 22200358 missense possibly damaging 0.90
R4440:Tbl1xr1 UTSW 3 22200588 critical splice acceptor site probably null
R4642:Tbl1xr1 UTSW 3 22188420 missense probably damaging 1.00
R5187:Tbl1xr1 UTSW 3 22209606 missense probably damaging 1.00
R5361:Tbl1xr1 UTSW 3 22192069 missense probably damaging 0.97
R5430:Tbl1xr1 UTSW 3 22192082 missense probably benign 0.01
R6490:Tbl1xr1 UTSW 3 22203977 missense probably damaging 0.97
R6512:Tbl1xr1 UTSW 3 22140534 intron probably benign
R6778:Tbl1xr1 UTSW 3 22189782 missense probably benign 0.00
R6861:Tbl1xr1 UTSW 3 22191439 missense possibly damaging 0.68
R6861:Tbl1xr1 UTSW 3 22191539 splice site probably null
R6878:Tbl1xr1 UTSW 3 22203204 missense possibly damaging 0.90
R6998:Tbl1xr1 UTSW 3 22179290 missense probably damaging 1.00
R7409:Tbl1xr1 UTSW 3 22203190 missense possibly damaging 0.56
R8029:Tbl1xr1 UTSW 3 22200436 missense probably damaging 0.98
X0011:Tbl1xr1 UTSW 3 22203092 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACATCACAGCATATTGGCC -3'
(R):5'- TTCACAAGCTGGGATGAGAC -3'

Sequencing Primer
(F):5'- TCACAGCATATTGGCCCGATG -3'
(R):5'- AGACTGTCATCTTCAGGGTACAGC -3'
Posted On2017-01-03