Incidental Mutation 'R5710:Znhit1'
List |< first << previous [record 41 of 41]
ID452163
Institutional Source Beutler Lab
Gene Symbol Znhit1
Ensembl Gene ENSMUSG00000059518
Gene Namezinc finger, HIT domain containing 1
Synonyms2700001K05Rik
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.738) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136982164-136988021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136982602 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 119 (C119Y)
Ref Sequence ENSEMBL: ENSMUSP00000115929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004968] [ENSMUST00000034953] [ENSMUST00000085941] [ENSMUST00000111090] [ENSMUST00000111091] [ENSMUST00000137272] [ENSMUST00000156963]
Predicted Effect probably benign
Transcript: ENSMUST00000004968
SMART Domains Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 312 324 N/A INTRINSIC
Blast:P4Hc 456 502 2e-8 BLAST
P4Hc 567 740 1.43e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000034953
AA Change: C119Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034953
Gene: ENSMUSG00000059518
AA Change: C119Y

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085941
AA Change: C120Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083103
Gene: ENSMUSG00000059518
AA Change: C120Y

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:zf-HIT 113 142 3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111090
AA Change: C119Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106719
Gene: ENSMUSG00000059518
AA Change: C119Y

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 2.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111091
AA Change: C124Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106720
Gene: ENSMUSG00000059518
AA Change: C124Y

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
Pfam:zf-HIT 117 146 2.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129896
Predicted Effect probably benign
Transcript: ENSMUST00000137272
SMART Domains Protein: ENSMUSP00000120331
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144784
Predicted Effect probably damaging
Transcript: ENSMUST00000156963
AA Change: C119Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115929
Gene: ENSMUSG00000059518
AA Change: C119Y

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Other mutations in Znhit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Znhit1 APN 5 136982583 nonsense probably null
IGL02401:Znhit1 APN 5 136982659 missense probably damaging 1.00
R0032:Znhit1 UTSW 5 136985047 missense possibly damaging 0.49
R5107:Znhit1 UTSW 5 136986828 missense probably benign
R5240:Znhit1 UTSW 5 136982381 splice site probably null
R6148:Znhit1 UTSW 5 136982633 missense probably benign 0.00
R6444:Znhit1 UTSW 5 136982400 missense probably benign 0.01
R6683:Znhit1 UTSW 5 136982633 missense probably benign 0.00
X0028:Znhit1 UTSW 5 136985000 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCACTTCAGACACCTGCAG -3'
(R):5'- GAAGGCTCAGTCTGAGGTTG -3'

Sequencing Primer
(F):5'- TTCAGACACCTGCAGAAAGAG -3'
(R):5'- TTGGGACCCTAGAGAGCAC -3'
Posted On2017-01-03