Incidental Mutation 'R5710:Fkbp14'
List |< first << previous [record 18 of 41] next >> last >|
ID452166
Institutional Source Beutler Lab
Gene Symbol Fkbp14
Ensembl Gene ENSMUSG00000038074
Gene NameFK506 binding protein 14
SynonymsFKBP22
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location54577604-54597308 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 54589270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046520] [ENSMUST00000117375] [ENSMUST00000117375] [ENSMUST00000155047]
Predicted Effect probably null
Transcript: ENSMUST00000046520
SMART Domains Protein: ENSMUSP00000046070
Gene: ENSMUSG00000038074

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 38 132 2e-28 PFAM
Pfam:EF-hand_7 116 207 3.7e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117375
SMART Domains Protein: ENSMUSP00000112526
Gene: ENSMUSG00000038074

DomainStartEndE-ValueType
Pfam:FKBP_C 1 38 1.1e-13 PFAM
EFh 45 73 4.08e1 SMART
EFh 89 117 2.56e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117375
SMART Domains Protein: ENSMUSP00000112526
Gene: ENSMUSG00000038074

DomainStartEndE-ValueType
Pfam:FKBP_C 1 38 1.1e-13 PFAM
EFh 45 73 4.08e1 SMART
EFh 89 117 2.56e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143312
Predicted Effect probably benign
Transcript: ENSMUST00000155047
SMART Domains Protein: ENSMUSP00000114521
Gene: ENSMUSG00000038074

DomainStartEndE-ValueType
Pfam:FKBP_C 38 117 7.3e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FK506-binding protein family of peptidyl-prolyl cis-trans isomerases. The encoded protein is found in the lumen of the endoplasmic reticulum, where it is thought to accelerate protein folding. Defects in this gene are a cause of a type of Ehlers-Danlos syndrome (EDS). Both a protein-coding variant and noncoding variants are transcribed from this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Fkbp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02953:Fkbp14 APN 6 54579682 missense probably damaging 1.00
IGL03056:Fkbp14 APN 6 54579544 missense probably benign 0.00
R4178:Fkbp14 UTSW 6 54589314 missense probably damaging 1.00
R4863:Fkbp14 UTSW 6 54585945 splice site probably benign
R4975:Fkbp14 UTSW 6 54592958 missense probably benign 0.01
R5714:Fkbp14 UTSW 6 54585850 missense probably damaging 1.00
R6671:Fkbp14 UTSW 6 54579677 missense probably damaging 1.00
R6792:Fkbp14 UTSW 6 54585852 nonsense probably null
R7606:Fkbp14 UTSW 6 54593018 missense probably benign 0.01
R7748:Fkbp14 UTSW 6 54595520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTTGTAGGGTCACTCAG -3'
(R):5'- TCCTTTCTGGCAGTCACAAAC -3'

Sequencing Primer
(F):5'- CTTGTAGGGTCACTCAGCAGGG -3'
(R):5'- CATAACAATGGTCAGCCTGTCTGG -3'
Posted On2017-01-03