Incidental Mutation 'R5710:Ccnd1'
ID452168
Institutional Source Beutler Lab
Gene Symbol Ccnd1
Ensembl Gene ENSMUSG00000070348
Gene Namecyclin D1
SynonymsCycD1, Cyl-1, cD1, PRAD1, bcl-1
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location144929931-144939925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144938044 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 86 (D86G)
Ref Sequence ENSEMBL: ENSMUSP00000091495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093962
AA Change: D86G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091495
Gene: ENSMUSG00000070348
AA Change: D86G

DomainStartEndE-ValueType
CYCLIN 62 146 1.2e-22 SMART
Cyclin_C 155 283 1.36e-18 SMART
CYCLIN 163 253 4.41e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208193
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of tumors and may contribute to tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations may exhibit reduced body size and viability, impaired retinal development, pregnancy-insensitive mammary glands, and modified development of mammary cancer induced by neu and ras oncogenes, depending on the specific allele or genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Ccnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Ccnd1 UTSW 7 144939665 missense probably benign 0.00
R0544:Ccnd1 UTSW 7 144937286 splice site probably benign
R1549:Ccnd1 UTSW 7 144937336 missense probably benign
R2054:Ccnd1 UTSW 7 144937391 missense possibly damaging 0.95
R3895:Ccnd1 UTSW 7 144937894 missense probably damaging 0.98
R3962:Ccnd1 UTSW 7 144934050 missense probably damaging 1.00
R5624:Ccnd1 UTSW 7 144938012 missense probably benign 0.00
R6380:Ccnd1 UTSW 7 144939569 missense probably benign 0.00
R7352:Ccnd1 UTSW 7 144937387 missense possibly damaging 0.86
R7672:Ccnd1 UTSW 7 144934056 missense possibly damaging 0.75
R7813:Ccnd1 UTSW 7 144937885 critical splice donor site probably null
R7841:Ccnd1 UTSW 7 144937981 missense probably damaging 1.00
R7924:Ccnd1 UTSW 7 144937981 missense probably damaging 1.00
X0026:Ccnd1 UTSW 7 144937952 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTACGTGGTTACCAGCAGCTC -3'
(R):5'- GCCCAAAGACTTTCCCTTTCAG -3'

Sequencing Primer
(F):5'- TTACCAGCAGCTCCTCGG -3'
(R):5'- AAAGACTTTCCCTTTCAGTTTCAGG -3'
Posted On2017-01-03