Incidental Mutation 'R5710:Adam39'
List |< first << previous [record 3 of 41] next >> last >|
ID452169
Institutional Source Beutler Lab
Gene Symbol Adam39
Ensembl Gene ENSMUSG00000054033
Gene Namea disintegrin and metallopeptidase domain 39
Synonyms1700056P18Rik, testase 9
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40822990-40827037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40824647 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 25 (Y25F)
Ref Sequence ENSEMBL: ENSMUSP00000065783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066814]
Predicted Effect probably benign
Transcript: ENSMUST00000066814
AA Change: Y25F

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065783
Gene: ENSMUSG00000054033
AA Change: Y25F

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 178 1.3e-19 PFAM
Pfam:Reprolysin_5 219 398 2.2e-18 PFAM
Pfam:Reprolysin_4 219 406 6.8e-16 PFAM
Pfam:Reprolysin 221 410 1.3e-43 PFAM
Pfam:Reprolysin_2 238 399 2.6e-12 PFAM
Pfam:Reprolysin_3 246 366 1.2e-17 PFAM
DISIN 428 503 3.97e-37 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 702 724 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Adam39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Adam39 APN 8 40826746 missense possibly damaging 0.53
IGL01350:Adam39 APN 8 40825839 nonsense probably null
IGL02237:Adam39 APN 8 40825445 missense probably benign 0.39
IGL02688:Adam39 APN 8 40826320 missense probably benign 0.00
IGL02890:Adam39 APN 8 40825153 missense probably benign 0.03
IGL03071:Adam39 APN 8 40825067 missense probably benign 0.08
IGL03145:Adam39 APN 8 40824658 missense probably benign 0.00
R0083:Adam39 UTSW 8 40825078 missense probably damaging 0.98
R0086:Adam39 UTSW 8 40826360 missense possibly damaging 0.64
R0546:Adam39 UTSW 8 40826431 missense probably damaging 1.00
R0548:Adam39 UTSW 8 40826467 missense probably damaging 1.00
R1489:Adam39 UTSW 8 40824994 missense possibly damaging 0.49
R1643:Adam39 UTSW 8 40826486 missense possibly damaging 0.83
R1756:Adam39 UTSW 8 40825324 missense probably damaging 0.99
R2081:Adam39 UTSW 8 40826842 makesense probably null
R4510:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4511:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4612:Adam39 UTSW 8 40825921 missense probably damaging 0.96
R4673:Adam39 UTSW 8 40824731 missense probably benign 0.37
R4704:Adam39 UTSW 8 40825796 missense probably benign
R4978:Adam39 UTSW 8 40825337 missense possibly damaging 0.49
R5116:Adam39 UTSW 8 40825001 missense probably damaging 1.00
R5269:Adam39 UTSW 8 40825981 missense probably benign 0.01
R5971:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6067:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6078:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6180:Adam39 UTSW 8 40826573 missense probably benign 0.03
R6358:Adam39 UTSW 8 40826681 missense probably benign 0.16
R6699:Adam39 UTSW 8 40826657 missense probably benign 0.01
R6896:Adam39 UTSW 8 40824938 missense possibly damaging 0.86
R7117:Adam39 UTSW 8 40826242 missense probably damaging 1.00
R7186:Adam39 UTSW 8 40826312 missense probably damaging 1.00
R7195:Adam39 UTSW 8 40824775 nonsense probably null
R7381:Adam39 UTSW 8 40825963 missense probably damaging 1.00
R7405:Adam39 UTSW 8 40824622 missense probably benign 0.01
R8068:Adam39 UTSW 8 40825938 missense not run
R8205:Adam39 UTSW 8 40825043 missense probably benign 0.06
R8239:Adam39 UTSW 8 40825069 missense probably damaging 1.00
U15987:Adam39 UTSW 8 40824593 missense probably benign 0.01
Z1177:Adam39 UTSW 8 40825295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTTGAACAAACCTCAGC -3'
(R):5'- CAGGCTATAGGTCAGCCATC -3'

Sequencing Primer
(F):5'- AGCCATTTAAGCTCACATCTTG -3'
(R):5'- GGCTATAGGTCAGCCATCCCATAG -3'
Posted On2017-01-03