Incidental Mutation 'R5710:A230050P20Rik'
ID452171
Institutional Source Beutler Lab
Gene Symbol A230050P20Rik
Ensembl Gene ENSMUSG00000038884
Gene NameRIKEN cDNA A230050P20 gene
Synonyms
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20868642-20874307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20872896 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 138 (R138L)
Ref Sequence ENSEMBL: ENSMUSP00000045384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043726] [ENSMUST00000043911]
Predicted Effect probably benign
Transcript: ENSMUST00000043726
SMART Domains Protein: ENSMUSP00000035784
Gene: ENSMUSG00000038742

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 51 77 N/A INTRINSIC
coiled coil region 126 164 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
FBG 242 455 7.15e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043911
AA Change: R138L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045384
Gene: ENSMUSG00000038884
AA Change: R138L

DomainStartEndE-ValueType
Pfam:UPF0515 16 272 1.3e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177067
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in A230050P20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0669:A230050P20Rik UTSW 9 20873717 small deletion probably benign
R0943:A230050P20Rik UTSW 9 20872962 missense possibly damaging 0.81
R1500:A230050P20Rik UTSW 9 20873717 small deletion probably benign
R2483:A230050P20Rik UTSW 9 20873177 missense possibly damaging 0.93
R2848:A230050P20Rik UTSW 9 20873572 missense probably damaging 0.98
R3055:A230050P20Rik UTSW 9 20873717 small deletion probably benign
R5089:A230050P20Rik UTSW 9 20868916 start codon destroyed probably benign 0.02
R7720:A230050P20Rik UTSW 9 20868859 start gained probably benign
R7726:A230050P20Rik UTSW 9 20873165 missense possibly damaging 0.89
R7863:A230050P20Rik UTSW 9 20871376 missense possibly damaging 0.57
R7946:A230050P20Rik UTSW 9 20871376 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GGCTTCCTAACCTCTTGATTACTAGTG -3'
(R):5'- GATTGTAGCAATCTGCAGCTGAG -3'

Sequencing Primer
(F):5'- AGCATTCATGAAGCCATCGGTTC -3'
(R):5'- GTACACAGGGAAGCCGCAC -3'
Posted On2017-01-03