Incidental Mutation 'R5710:Lipc'
List |< first << previous [record 21 of 41] next >> last >|
ID452173
Institutional Source Beutler Lab
Gene Symbol Lipc
Ensembl Gene ENSMUSG00000032207
Gene Namelipase, hepatic
SynonymsHpl, HL
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5710 (G1)
Quality Score123
Status Not validated
Chromosome9
Chromosomal Location70798128-70952226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70812697 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 343 (I343F)
Ref Sequence ENSEMBL: ENSMUSP00000034731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000216798]
Predicted Effect probably benign
Transcript: ENSMUST00000034731
AA Change: I343F

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: I343F

DomainStartEndE-ValueType
Pfam:Lipase 14 350 1.1e-136 PFAM
LH2 353 488 4.62e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216798
AA Change: I258F

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Lipc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lipc APN 9 70820437 missense possibly damaging 0.56
IGL02431:Lipc APN 9 70934468 intron probably benign
Immunobolic UTSW 9 70823386 missense probably damaging 1.00
R0112:Lipc UTSW 9 70820427 missense probably damaging 1.00
R0114:Lipc UTSW 9 70803781 missense probably damaging 0.99
R0545:Lipc UTSW 9 70812705 missense probably damaging 1.00
R1051:Lipc UTSW 9 70802116 missense probably benign 0.00
R1069:Lipc UTSW 9 70823537 missense probably benign 0.03
R1350:Lipc UTSW 9 70798367 missense probably benign 0.00
R1742:Lipc UTSW 9 70820529 missense probably damaging 1.00
R2145:Lipc UTSW 9 70934535 missense possibly damaging 0.94
R3880:Lipc UTSW 9 70820518 missense probably damaging 0.99
R4360:Lipc UTSW 9 70852582 intron probably benign
R4999:Lipc UTSW 9 70816731 missense probably benign 0.00
R5159:Lipc UTSW 9 70812910 missense probably benign 0.03
R5197:Lipc UTSW 9 70798391 missense probably benign 0.11
R5458:Lipc UTSW 9 70852582 intron probably benign
R6645:Lipc UTSW 9 70803748 missense probably damaging 1.00
R6749:Lipc UTSW 9 70823386 missense probably damaging 1.00
R6849:Lipc UTSW 9 70818847 critical splice donor site probably null
R7011:Lipc UTSW 9 70818954 missense probably benign 0.09
R7346:Lipc UTSW 9 70812747 missense probably damaging 1.00
R7426:Lipc UTSW 9 70802168 missense probably benign 0.21
R7587:Lipc UTSW 9 70818924 missense probably damaging 1.00
R7830:Lipc UTSW 9 70812901 missense probably damaging 1.00
R8269:Lipc UTSW 9 70820373 missense probably damaging 1.00
X0054:Lipc UTSW 9 70812748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAAATAGGCTGTCAGC -3'
(R):5'- AAATGTGCCCATGAGCGCTC -3'

Sequencing Primer
(F):5'- CACTGTTGGTAAGACAATGCTG -3'
(R):5'- ATGAGCGCTCCGTGCAC -3'
Posted On2017-01-03