Incidental Mutation 'R5710:Bcl2a1b'
List [record 1 of 41] next >> last >|
ID452175
Institutional Source Beutler Lab
Gene Symbol Bcl2a1b
Ensembl Gene ENSMUSG00000089929
Gene NameB cell leukemia/lymphoma 2 related protein A1b
SynonymsA1-b
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89199209-89207827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89199679 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 107 (Q107P)
Ref Sequence ENSEMBL: ENSMUSP00000065612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068569]
Predicted Effect probably benign
Transcript: ENSMUST00000068569
AA Change: Q107P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065612
Gene: ENSMUSG00000089929
AA Change: Q107P

DomainStartEndE-ValueType
BCL 37 140 5.55e-40 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138109
AA Change: Q100P
SMART Domains Protein: ENSMUSP00000119881
Gene: ENSMUSG00000100838
AA Change: Q100P

DomainStartEndE-ValueType
BCL 31 134 5.55e-40 SMART
PDB:3HY6|A 135 221 4e-49 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Bcl2a1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0379:Bcl2a1b UTSW 9 89199736 missense possibly damaging 0.95
R1307:Bcl2a1b UTSW 9 89199490 missense probably damaging 0.99
R2402:Bcl2a1b UTSW 9 89199742 missense probably benign 0.06
R4898:Bcl2a1b UTSW 9 89199660 nonsense probably null
R5098:Bcl2a1b UTSW 9 89199379 missense probably benign 0.00
R6594:Bcl2a1b UTSW 9 89207594 missense probably benign
R7059:Bcl2a1b UTSW 9 89199760 missense probably damaging 1.00
W0251:Bcl2a1b UTSW 9 89199583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCTTTCTCCGTTCAGAAGG -3'
(R):5'- CAGACTGAAGTCCTTTGATTGTTAC -3'

Sequencing Primer
(F):5'- TCTCCGTTCAGAAGGAAGTTG -3'
(R):5'- GAAGTCCTTTGATTGTTACTTTCTTG -3'
Posted On2017-01-03