Incidental Mutation 'R5710:Arhgap18'
ID452177
Institutional Source Beutler Lab
Gene Symbol Arhgap18
Ensembl Gene ENSMUSG00000039031
Gene NameRho GTPase activating protein 18
Synonyms
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location26753421-26918648 bp(+) (GRCm38)
Type of Mutationunclassified (1 bp from exon)
DNA Base Change (assembly) G to A at 26860733 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039557] [ENSMUST00000176060]
Predicted Effect probably null
Transcript: ENSMUST00000039557
SMART Domains Protein: ENSMUSP00000044834
Gene: ENSMUSG00000039031

DomainStartEndE-ValueType
low complexity region 100 114 N/A INTRINSIC
RhoGAP 340 520 8.99e-42 SMART
coiled coil region 535 557 N/A INTRINSIC
Blast:RhoGAP 572 613 1e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142284
Predicted Effect probably null
Transcript: ENSMUST00000176060
SMART Domains Protein: ENSMUSP00000135030
Gene: ENSMUSG00000039031

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP18 belongs to a family of Rho (see MIM 165390) GTPase-activating proteins that modulate cell signaling (Potkin et al., 2009 [PubMed 19065146]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Arhgap18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Arhgap18 APN 10 26880748 missense possibly damaging 0.75
IGL02393:Arhgap18 APN 10 26877183 missense probably benign 0.07
IGL03368:Arhgap18 APN 10 26772693 missense possibly damaging 0.60
Half_pint UTSW 10 26772698 critical splice donor site probably null
R0698:Arhgap18 UTSW 10 26912629 missense probably damaging 1.00
R1456:Arhgap18 UTSW 10 26916440 missense probably benign 0.29
R1532:Arhgap18 UTSW 10 26860722 missense possibly damaging 0.69
R1768:Arhgap18 UTSW 10 26887861 missense probably damaging 1.00
R1768:Arhgap18 UTSW 10 26887862 missense probably damaging 1.00
R1793:Arhgap18 UTSW 10 26860736 unclassified probably benign
R1867:Arhgap18 UTSW 10 26846030 missense probably damaging 0.99
R2020:Arhgap18 UTSW 10 26854904 missense probably benign
R2049:Arhgap18 UTSW 10 26849942 missense probably benign 0.00
R2056:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2058:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2986:Arhgap18 UTSW 10 26854907 missense probably benign 0.00
R3027:Arhgap18 UTSW 10 26846096 missense probably benign
R5103:Arhgap18 UTSW 10 26869982 missense probably damaging 1.00
R5468:Arhgap18 UTSW 10 26912671 missense probably damaging 0.99
R5532:Arhgap18 UTSW 10 26846108 missense possibly damaging 0.56
R6019:Arhgap18 UTSW 10 26860650 missense probably damaging 0.98
R6190:Arhgap18 UTSW 10 26846035 start codon destroyed probably null 0.22
R6346:Arhgap18 UTSW 10 26846065 missense probably damaging 1.00
R6438:Arhgap18 UTSW 10 26772698 critical splice donor site probably null
R6572:Arhgap18 UTSW 10 26846416 intron probably null
R6799:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R6844:Arhgap18 UTSW 10 26772686 missense probably benign 0.04
R7051:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R7084:Arhgap18 UTSW 10 26872738 missense possibly damaging 0.77
R7727:Arhgap18 UTSW 10 26870011 missense possibly damaging 0.83
R8046:Arhgap18 UTSW 10 26887857 missense probably damaging 0.98
Z1088:Arhgap18 UTSW 10 26850004 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ATCTAGTGGGGCTGTCGATAGC -3'
(R):5'- GAATGTTATGCCACCAACTTTTCTG -3'

Sequencing Primer
(F):5'- GCTGTCGATAGCAAGGAGC -3'
(R):5'- AGAAATTCTTGCCAGGCGTG -3'
Posted On2017-01-03