Incidental Mutation 'R5710:Havcr1'
ID452179
Institutional Source Beutler Lab
Gene Symbol Havcr1
Ensembl Gene ENSMUSG00000040405
Gene Namehepatitis A virus cellular receptor 1
SynonymsKIM-1, Tim1, TIM-1
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46735080-46779578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46752526 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000104847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047568] [ENSMUST00000081819] [ENSMUST00000109223] [ENSMUST00000109224]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047568
AA Change: V91A

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043827
Gene: ENSMUSG00000040405
AA Change: V91A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081819
AA Change: V91A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080503
Gene: ENSMUSG00000040405
AA Change: V91A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109223
AA Change: V91A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104846
Gene: ENSMUSG00000040405
AA Change: V91A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109224
AA Change: V91A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104847
Gene: ENSMUSG00000040405
AA Change: V91A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to S. mansoni egg challenge. Mice homozygous for an allele lacking the mucin domain display impaired regulatory B cell function and systemic autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Havcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Havcr1 APN 11 46775493 missense probably damaging 1.00
IGL02207:Havcr1 APN 11 46778576 missense probably benign 0.28
R0355:Havcr1 UTSW 11 46756224 missense possibly damaging 0.91
R0371:Havcr1 UTSW 11 46752589 missense possibly damaging 0.95
R0488:Havcr1 UTSW 11 46752571 missense probably damaging 1.00
R0883:Havcr1 UTSW 11 46752432 missense probably damaging 1.00
R1307:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1308:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1554:Havcr1 UTSW 11 46752507 missense probably benign
R1908:Havcr1 UTSW 11 46773684 nonsense probably null
R2165:Havcr1 UTSW 11 46778552 missense probably benign 0.14
R3085:Havcr1 UTSW 11 46756225 missense probably damaging 0.99
R3757:Havcr1 UTSW 11 46752580 missense probably damaging 1.00
R4719:Havcr1 UTSW 11 46752441 missense probably benign 0.02
R5191:Havcr1 UTSW 11 46756197 missense probably benign 0.40
R5440:Havcr1 UTSW 11 46752370 missense probably damaging 1.00
R5988:Havcr1 UTSW 11 46756137 missense probably damaging 1.00
R7570:Havcr1 UTSW 11 46770542 critical splice donor site probably null
Z1177:Havcr1 UTSW 11 46775498 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACAGGCGCTGTGGATTCTTATG -3'
(R):5'- AGACCTTCAGTTTCCTTGTCATAGG -3'

Sequencing Primer
(F):5'- TGGGTCACCCTGTCACAC -3'
(R):5'- TCAAATTATTAGCAAACAAAAGACCC -3'
Posted On2017-01-03