Incidental Mutation 'R0552:Klhl41'
ID45218
Institutional Source Beutler Lab
Gene Symbol Klhl41
Ensembl Gene ENSMUSG00000075307
Gene Namekelch-like 41
SynonymsLOC228003, Kbtbd10
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69670120-69684230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69670210 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 5 (R5Q)
Ref Sequence ENSEMBL: ENSMUSP00000097627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074963] [ENSMUST00000100050] [ENSMUST00000112286] [ENSMUST00000134659]
Predicted Effect probably benign
Transcript: ENSMUST00000074963
SMART Domains Protein: ENSMUSP00000074494
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 7 339 6.2e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100050
AA Change: R5Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: R5Q

DomainStartEndE-ValueType
BTB 33 130 8.34e-27 SMART
BACK 135 237 9.67e-36 SMART
Kelch 346 398 6.71e-1 SMART
Kelch 399 447 1.56e-5 SMART
Kelch 448 495 2.43e-7 SMART
Kelch 496 542 5.81e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112286
SMART Domains Protein: ENSMUSP00000107905
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 208 1.6e-100 PFAM
Pfam:DUF1448 206 319 9.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127806
SMART Domains Protein: ENSMUSP00000121691
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 22 90 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134659
SMART Domains Protein: ENSMUSP00000119377
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 88 3.1e-36 PFAM
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Klhl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Klhl41 APN 2 69674724 missense probably benign 0.00
IGL01622:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL01623:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL03237:Klhl41 APN 2 69670558 missense possibly damaging 0.94
R0220:Klhl41 UTSW 2 69670485 missense probably benign 0.25
R0277:Klhl41 UTSW 2 69671296 missense probably damaging 1.00
R0456:Klhl41 UTSW 2 69670549 missense probably damaging 0.99
R0485:Klhl41 UTSW 2 69671256 missense probably damaging 0.97
R0536:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0537:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0553:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0834:Klhl41 UTSW 2 69678147 missense possibly damaging 0.76
R0879:Klhl41 UTSW 2 69683483 unclassified probably benign
R1531:Klhl41 UTSW 2 69670740 missense probably benign 0.03
R1678:Klhl41 UTSW 2 69670939 missense probably benign 0.01
R1792:Klhl41 UTSW 2 69670802 missense probably benign 0.01
R1900:Klhl41 UTSW 2 69674619 splice site probably benign
R2012:Klhl41 UTSW 2 69683496 missense possibly damaging 0.61
R4041:Klhl41 UTSW 2 69670710 missense probably benign 0.00
R5223:Klhl41 UTSW 2 69679827 nonsense probably null
R5500:Klhl41 UTSW 2 69683529 missense probably damaging 1.00
R5643:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5644:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5656:Klhl41 UTSW 2 69683532 missense possibly damaging 0.89
R6264:Klhl41 UTSW 2 69679832 critical splice donor site probably null
R6678:Klhl41 UTSW 2 69670844 missense probably benign 0.04
R6731:Klhl41 UTSW 2 69674700 missense probably damaging 1.00
R7586:Klhl41 UTSW 2 69674724 missense probably benign 0.33
R7664:Klhl41 UTSW 2 69670717 missense probably damaging 1.00
R8158:Klhl41 UTSW 2 69671161 missense probably damaging 1.00
X0021:Klhl41 UTSW 2 69679706 missense probably damaging 1.00
Z1088:Klhl41 UTSW 2 69674730 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGCTGAACAGCAGCACTCCTTTCC -3'
(R):5'- ATCCACGTTGTCTAGGGCTACCTC -3'

Sequencing Primer
(F):5'- CCTAAATTCCCGTTGTTAGAGC -3'
(R):5'- GTCTAGGGCTACCTCCTTTTTTTTC -3'
Posted On2013-06-11