Incidental Mutation 'R5710:Ankfn1'
List |< first << previous [record 4 of 41] next >> last >|
ID452180
Institutional Source Beutler Lab
Gene Symbol Ankfn1
Ensembl Gene ENSMUSG00000047773
Gene Nameankyrin-repeat and fibronectin type III domain containing 1
SynonymsLOC382543
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location89390223-89777653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89503925 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 278 (N278S)
Ref Sequence ENSEMBL: ENSMUSP00000132133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128717] [ENSMUST00000169201]
Predicted Effect unknown
Transcript: ENSMUST00000128717
AA Change: N298S
SMART Domains Protein: ENSMUSP00000121290
Gene: ENSMUSG00000047773
AA Change: N298S

DomainStartEndE-ValueType
ANK 136 167 2.47e2 SMART
ANK 173 204 1.46e-2 SMART
coiled coil region 205 236 N/A INTRINSIC
FN3 271 356 1.66e-7 SMART
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169201
AA Change: N278S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132133
Gene: ENSMUSG00000047773
AA Change: N278S

DomainStartEndE-ValueType
ANK 116 147 2.47e2 SMART
ANK 153 184 1.46e-2 SMART
coiled coil region 185 216 N/A INTRINSIC
FN3 251 336 1.66e-7 SMART
low complexity region 566 577 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207815
AA Change: N232S
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutant mice exhibit a variable and subtle head nodding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Ankfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Ankfn1 APN 11 89391639 missense probably benign 0.01
IGL02519:Ankfn1 APN 11 89405678 missense probably benign
IGL02695:Ankfn1 APN 11 89391819 missense probably damaging 0.99
IGL02818:Ankfn1 APN 11 89538466 missense probably benign
IGL02821:Ankfn1 APN 11 89391616 missense probably benign 0.00
IGL03166:Ankfn1 APN 11 89538438 missense probably benign 0.19
R0056:Ankfn1 UTSW 11 89391676 missense possibly damaging 0.71
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0200:Ankfn1 UTSW 11 89441966 missense possibly damaging 0.67
R0427:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R0755:Ankfn1 UTSW 11 89392087 missense probably benign
R1240:Ankfn1 UTSW 11 89392134 missense probably damaging 0.99
R1534:Ankfn1 UTSW 11 89523151 missense probably damaging 1.00
R1539:Ankfn1 UTSW 11 89441391 missense probably damaging 1.00
R1548:Ankfn1 UTSW 11 89526541 missense probably damaging 0.98
R1595:Ankfn1 UTSW 11 89422767 critical splice donor site probably null
R1776:Ankfn1 UTSW 11 89526474 missense possibly damaging 0.74
R1835:Ankfn1 UTSW 11 89447618 missense probably benign 0.25
R2012:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R2037:Ankfn1 UTSW 11 89456120 missense probably benign 0.13
R2175:Ankfn1 UTSW 11 89526537 missense probably damaging 1.00
R2876:Ankfn1 UTSW 11 89391636 missense possibly damaging 0.90
R3778:Ankfn1 UTSW 11 89441394 missense probably damaging 1.00
R4720:Ankfn1 UTSW 11 89441426 missense possibly damaging 0.50
R5001:Ankfn1 UTSW 11 89441442 missense possibly damaging 0.85
R5318:Ankfn1 UTSW 11 89391928 missense probably damaging 0.96
R5412:Ankfn1 UTSW 11 89505181 missense probably benign 0.17
R5434:Ankfn1 UTSW 11 89453187 missense probably damaging 1.00
R5458:Ankfn1 UTSW 11 89434810 missense probably benign 0.00
R6457:Ankfn1 UTSW 11 89391844 missense probably benign 0.00
R7026:Ankfn1 UTSW 11 89639577 makesense probably null
R7356:Ankfn1 UTSW 11 89434773 missense probably damaging 0.97
R7499:Ankfn1 UTSW 11 89391750 missense probably benign 0.12
R7572:Ankfn1 UTSW 11 89421271 missense probably benign
R7577:Ankfn1 UTSW 11 89503971 missense probably benign 0.04
R7582:Ankfn1 UTSW 11 89526619 missense probably benign 0.04
R7820:Ankfn1 UTSW 11 89421130 missense probably damaging 0.99
R7908:Ankfn1 UTSW 11 89405534 missense probably damaging 1.00
R7989:Ankfn1 UTSW 11 89405534 missense probably damaging 1.00
R8137:Ankfn1 UTSW 11 89453177 missense probably benign 0.00
X0012:Ankfn1 UTSW 11 89425544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAATCTTCACAGTGATGTG -3'
(R):5'- TCCTCTACCCTTTAAGGAGGCAG -3'

Sequencing Primer
(F):5'- AATCTTCACAGTGATGTGTGTGG -3'
(R):5'- CTACCCTTTAAGGAGGCAGAAATATG -3'
Posted On2017-01-03