Incidental Mutation 'R5710:Chdh'
List |< first << previous [record 11 of 41] next >> last >|
ID452185
Institutional Source Beutler Lab
Gene Symbol Chdh
Ensembl Gene ENSMUSG00000015970
Gene Namecholine dehydrogenase
SynonymsD630034H06Rik
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30009023-30040527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30034627 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 337 (Q337K)
Ref Sequence ENSEMBL: ENSMUSP00000112916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000118917]
Predicted Effect probably damaging
Transcript: ENSMUST00000067620
AA Change: Q337K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970
AA Change: Q337K

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118917
AA Change: Q337K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970
AA Change: Q337K

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a choline dehydrogenase that localizes to the mitochondrion. Variations in this gene can affect susceptibility to choline deficiency. A few transcript variants have been found for this gene, but the full-length nature of only one has been characterized to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous male mutants show reduced fertility due to reduced sperm motility caused by abnormal mitochondrial function and structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Chdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Chdh APN 14 30031332 missense probably benign 0.15
IGL01309:Chdh APN 14 30035804 unclassified probably benign
IGL01515:Chdh APN 14 30036886 missense probably damaging 1.00
IGL01828:Chdh APN 14 30036608 missense probably damaging 0.96
IGL01953:Chdh APN 14 30035347 missense probably benign 0.24
IGL01989:Chdh APN 14 30031731 missense possibly damaging 0.71
IGL02325:Chdh APN 14 30032825 missense probably benign 0.01
IGL02620:Chdh APN 14 30031139 missense probably damaging 0.99
IGL03180:Chdh APN 14 30034602 splice site probably null
R0024:Chdh UTSW 14 30031596 missense possibly damaging 0.81
R0455:Chdh UTSW 14 30034646 missense probably damaging 1.00
R0486:Chdh UTSW 14 30032858 missense possibly damaging 0.83
R0668:Chdh UTSW 14 30035880 missense probably damaging 1.00
R0684:Chdh UTSW 14 30031613 missense probably damaging 1.00
R0971:Chdh UTSW 14 30033663 missense probably damaging 1.00
R1291:Chdh UTSW 14 30031562 nonsense probably null
R1381:Chdh UTSW 14 30036834 missense probably damaging 1.00
R1386:Chdh UTSW 14 30031434 missense probably damaging 1.00
R1412:Chdh UTSW 14 30034723 missense probably benign 0.01
R1912:Chdh UTSW 14 30032788 missense probably benign 0.00
R2198:Chdh UTSW 14 30031532 missense possibly damaging 0.91
R4077:Chdh UTSW 14 30035340 missense probably damaging 0.99
R4412:Chdh UTSW 14 30031715 missense probably damaging 1.00
R4713:Chdh UTSW 14 30036841 missense probably benign 0.28
R4865:Chdh UTSW 14 30033724 missense probably benign 0.00
R4940:Chdh UTSW 14 30032852 missense possibly damaging 0.82
R5207:Chdh UTSW 14 30031361 missense probably damaging 1.00
R5582:Chdh UTSW 14 30036859 missense probably damaging 1.00
R5954:Chdh UTSW 14 30031181 missense possibly damaging 0.87
R6245:Chdh UTSW 14 30035305 missense probably damaging 0.99
R7032:Chdh UTSW 14 30036852 missense possibly damaging 0.89
R7868:Chdh UTSW 14 30031331 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGAAAGAGCCAGACTTGTC -3'
(R):5'- ATACCTAGCAACCTGAGGCC -3'

Sequencing Primer
(F):5'- GCCAGACTTGTCTAAGAGAGC -3'
(R):5'- GTCTTGGCTCTTCAGGAAGAAAACC -3'
Posted On2017-01-03