Incidental Mutation 'R5710:Zhx2'
ID452187
Institutional Source Beutler Lab
Gene Symbol Zhx2
Ensembl Gene ENSMUSG00000071757
Gene Namezinc fingers and homeoboxes 2
SynonymsAfr1, Raf, Afr-1
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location57694665-57839832 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57821470 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 78 (Y78*)
Ref Sequence ENSEMBL: ENSMUSP00000094164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096430]
Predicted Effect probably null
Transcript: ENSMUST00000096430
AA Change: Y78*
SMART Domains Protein: ENSMUSP00000094164
Gene: ENSMUSG00000071757
AA Change: Y78*

DomainStartEndE-ValueType
ZnF_C2H2 78 101 1.79e-2 SMART
ZnF_C2H2 110 133 1.99e0 SMART
low complexity region 191 209 N/A INTRINSIC
HOX 263 324 2.11e-3 SMART
HOX 439 501 4.94e-8 SMART
HOX 530 591 2.8e-7 SMART
HOX 628 690 3.09e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Alpha-fetoprotein levels in plasma decline precipitously after birth. This gene regulates a difference in adult level and rate of neonatal decrease of AFP. The BALB/cJ substrain carries a genetic variant allele determining a slow rate of decline to adultlevel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Zhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Zhx2 APN 15 57822870 missense probably damaging 1.00
IGL00694:Zhx2 APN 15 57821760 missense probably benign
IGL02407:Zhx2 APN 15 57823406 missense probably benign 0.00
IGL02456:Zhx2 APN 15 57823639 missense possibly damaging 0.72
IGL02737:Zhx2 APN 15 57822267 missense probably damaging 1.00
IGL03050:Zhx2 UTSW 15 57822833 missense possibly damaging 0.90
R0010:Zhx2 UTSW 15 57821274 missense possibly damaging 0.92
R0105:Zhx2 UTSW 15 57822695 missense probably damaging 1.00
R0420:Zhx2 UTSW 15 57821840 missense probably damaging 1.00
R0799:Zhx2 UTSW 15 57821313 missense probably benign
R0800:Zhx2 UTSW 15 57822728 missense probably damaging 1.00
R2273:Zhx2 UTSW 15 57823169 missense probably benign 0.30
R2497:Zhx2 UTSW 15 57823155 missense possibly damaging 0.48
R4198:Zhx2 UTSW 15 57821729 missense probably benign
R4372:Zhx2 UTSW 15 57823301 missense probably benign 0.02
R4992:Zhx2 UTSW 15 57823587 missense probably damaging 0.96
R4994:Zhx2 UTSW 15 57821359 missense probably benign 0.03
R5085:Zhx2 UTSW 15 57822693 missense probably damaging 1.00
R5141:Zhx2 UTSW 15 57821786 missense probably benign 0.00
R5470:Zhx2 UTSW 15 57823074 missense possibly damaging 0.76
R5659:Zhx2 UTSW 15 57822308 missense probably benign
R6171:Zhx2 UTSW 15 57823206 missense probably damaging 1.00
R7181:Zhx2 UTSW 15 57823350 missense probably benign
R7215:Zhx2 UTSW 15 57823643 missense probably benign
R7273:Zhx2 UTSW 15 57823428 missense probably benign 0.09
R7575:Zhx2 UTSW 15 57823262 missense probably damaging 1.00
R7662:Zhx2 UTSW 15 57822176 missense probably damaging 1.00
R7883:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
R7966:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGGCAAGCAAACGGAAATCTAC -3'
(R):5'- CCGGATGGAACTTGGAGTTG -3'

Sequencing Primer
(F):5'- CATGGTTCGGACATCACAGGTAC -3'
(R):5'- ACTTGGAGTTGTGGTCAGACAAG -3'
Posted On2017-01-03