Incidental Mutation 'R5710:Cpt1b'
List |< first << previous [record 13 of 41] next >> last >|
ID452189
Institutional Source Beutler Lab
Gene Symbol Cpt1b
Ensembl Gene ENSMUSG00000078937
Gene Namecarnitine palmitoyltransferase 1b, muscle
SynonymsM-CPTI, M-CPT I, Cpt1
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89416405-89425863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89425206 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 41 (K41N)
Ref Sequence ENSEMBL: ENSMUSP00000129786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023289] [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376] [ENSMUST00000168646] [ENSMUST00000170460] [ENSMUST00000171666]
Predicted Effect probably benign
Transcript: ENSMUST00000023289
SMART Domains Protein: ENSMUSP00000023289
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:APH 70 317 1.9e-14 PFAM
Pfam:Choline_kinase 97 308 1.5e-76 PFAM
low complexity region 324 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052315
Predicted Effect probably damaging
Transcript: ENSMUST00000109313
AA Change: K41N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937
AA Change: K41N

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166267
Predicted Effect probably damaging
Transcript: ENSMUST00000168376
AA Change: K41N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937
AA Change: K41N

DomainStartEndE-ValueType
PDB:2LE3|A 1 42 1e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168646
Predicted Effect probably benign
Transcript: ENSMUST00000168879
SMART Domains Protein: ENSMUSP00000128188
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 3 148 3.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170334
Predicted Effect probably benign
Transcript: ENSMUST00000170460
SMART Domains Protein: ENSMUSP00000128026
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 176 1e-65 PFAM
Pfam:APH 8 176 6.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171140
Predicted Effect probably benign
Transcript: ENSMUST00000171666
SMART Domains Protein: ENSMUSP00000127191
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 142 2.5e-51 PFAM
Pfam:APH 1 149 6.9e-14 PFAM
Pfam:EcKinase 2 116 8.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice die in utero prior to E9.5. Heterozygous mutant mice exhibit susceptibility to fatal hypothermia following cold exposure, with females more severely affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Cpt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cpt1b APN 15 89420863 missense probably benign 0.01
IGL00497:Cpt1b APN 15 89422293 missense probably benign 0.22
IGL01142:Cpt1b APN 15 89418993 missense probably benign
IGL02329:Cpt1b APN 15 89423739 missense probably benign
IGL02740:Cpt1b APN 15 89424332 missense probably damaging 1.00
IGL03196:Cpt1b APN 15 89424395 missense probably benign
oleagenous UTSW 15 89425214 missense probably damaging 1.00
IGL02796:Cpt1b UTSW 15 89424802 missense probably benign 0.04
PIT4519001:Cpt1b UTSW 15 89418863 missense probably damaging 1.00
R0276:Cpt1b UTSW 15 89419959 missense probably benign 0.12
R0302:Cpt1b UTSW 15 89417870 missense probably benign
R0454:Cpt1b UTSW 15 89424393 missense possibly damaging 0.47
R1199:Cpt1b UTSW 15 89419010 missense probably benign 0.01
R1633:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
R1674:Cpt1b UTSW 15 89422332 missense possibly damaging 0.64
R2087:Cpt1b UTSW 15 89422208 missense probably benign 0.07
R2178:Cpt1b UTSW 15 89419043 missense probably damaging 1.00
R2414:Cpt1b UTSW 15 89420080 splice site probably benign
R2507:Cpt1b UTSW 15 89419098 missense probably benign 0.08
R2883:Cpt1b UTSW 15 89417869 missense probably benign 0.00
R3432:Cpt1b UTSW 15 89423741 missense possibly damaging 0.85
R3783:Cpt1b UTSW 15 89425189 missense probably damaging 1.00
R4574:Cpt1b UTSW 15 89424044 splice site probably null
R4737:Cpt1b UTSW 15 89421406 missense probably benign 0.03
R5122:Cpt1b UTSW 15 89424023 missense probably benign 0.09
R5320:Cpt1b UTSW 15 89419274 missense probably benign 0.00
R5365:Cpt1b UTSW 15 89420107 missense possibly damaging 0.78
R5699:Cpt1b UTSW 15 89424273 missense probably benign 0.44
R5873:Cpt1b UTSW 15 89420728 missense probably damaging 1.00
R5941:Cpt1b UTSW 15 89425214 missense probably damaging 1.00
R6163:Cpt1b UTSW 15 89424417 missense probably benign 0.15
R6197:Cpt1b UTSW 15 89424834 missense possibly damaging 0.77
R6323:Cpt1b UTSW 15 89419063 missense probably benign 0.10
R6486:Cpt1b UTSW 15 89420824 missense probably benign
R7571:Cpt1b UTSW 15 89421343 critical splice donor site probably null
R7648:Cpt1b UTSW 15 89421367 missense probably damaging 1.00
R7743:Cpt1b UTSW 15 89421404 missense probably benign 0.25
R7893:Cpt1b UTSW 15 89423654 critical splice donor site probably null
R7976:Cpt1b UTSW 15 89423654 critical splice donor site probably null
R8021:Cpt1b UTSW 15 89421426 missense probably benign 0.00
R8207:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAATATCACTAGGCCCCTGGGTAG -3'
(R):5'- ACACTAAGCACCTTCTGGC -3'

Sequencing Primer
(F):5'- ACTAGGCCCCTGGGTAGTCTTG -3'
(R):5'- GCCCTGTTAGGTGCTGAATAAACC -3'
Posted On2017-01-03