Incidental Mutation 'R5710:Vdr'
List |< first << previous [record 39 of 41] next >> last >|
ID452191
Institutional Source Beutler Lab
Gene Symbol Vdr
Ensembl Gene ENSMUSG00000022479
Gene Namevitamin D (1,25-dihydroxyvitamin D3) receptor
SynonymsNr1i1
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97854425-97910630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97867208 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 217 (S217T)
Ref Sequence ENSEMBL: ENSMUSP00000023119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023119]
Predicted Effect probably benign
Transcript: ENSMUST00000023119
AA Change: S217T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479
AA Change: S217T

DomainStartEndE-ValueType
ZnF_C4 21 92 1.4e-34 SMART
low complexity region 102 114 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
HOLI 227 389 3.54e-36 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Vdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Vdr APN 15 97884854 missense probably damaging 1.00
IGL02813:Vdr APN 15 97869681 missense probably benign 0.45
yangshuo UTSW 15 97859121 missense probably damaging 1.00
R0400:Vdr UTSW 15 97869351 missense probably benign 0.00
R1102:Vdr UTSW 15 97859121 missense probably damaging 1.00
R1172:Vdr UTSW 15 97869333 missense probably benign 0.05
R1173:Vdr UTSW 15 97869333 missense probably benign 0.05
R1268:Vdr UTSW 15 97857475 missense probably benign 0.39
R1705:Vdr UTSW 15 97867171 missense probably damaging 1.00
R2879:Vdr UTSW 15 97859127 missense probably benign 0.01
R3030:Vdr UTSW 15 97857563 missense probably benign 0.00
R4695:Vdr UTSW 15 97858920 splice site probably null
R5074:Vdr UTSW 15 97857578 missense probably benign 0.35
R5710:Vdr UTSW 15 97859127 missense probably damaging 1.00
R5845:Vdr UTSW 15 97869766 missense possibly damaging 0.46
R5982:Vdr UTSW 15 97857596 missense probably benign 0.37
R6776:Vdr UTSW 15 97869828 missense probably damaging 1.00
R6865:Vdr UTSW 15 97857505 missense probably damaging 1.00
R7870:Vdr UTSW 15 97884890 missense possibly damaging 0.59
R7953:Vdr UTSW 15 97884890 missense possibly damaging 0.59
X0023:Vdr UTSW 15 97869818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTATATCCTGGCCTTGTCCAG -3'
(R):5'- TTGGATCCTCTAAGGCACACAAG -3'

Sequencing Primer
(F):5'- GTTCCCGTTGGGCACTCTG -3'
(R):5'- GGCACACAAGGTTCTCACAGG -3'
Posted On2017-01-03