Incidental Mutation 'R5710:T'
ID452192
Institutional Source Beutler Lab
Gene Symbol T
Ensembl Gene ENSMUSG00000062327
Gene Namebrachyury, T-box transcription factor T
SynonymsBra, cou, Low, low ratio, Lr, me75, T1, Tl2, Tl3
MMRRC Submission 044396-MU
Accession Numbers

Genbank: NM_009309.2

Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location8434423-8442496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8441642 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 221 (S221P)
Ref Sequence ENSEMBL: ENSMUSP00000135526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074667] [ENSMUST00000136922] [ENSMUST00000177118]
Predicted Effect probably benign
Transcript: ENSMUST00000074667
AA Change: S362P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074236
Gene: ENSMUSG00000062327
AA Change: S362P

DomainStartEndE-ValueType
TBOX 41 224 5.53e-120 SMART
low complexity region 391 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136922
SMART Domains Protein: ENSMUSP00000119581
Gene: ENSMUSG00000062327

DomainStartEndE-ValueType
TBOX 1 137 3.02e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177118
AA Change: S221P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135526
Gene: ENSMUSG00000062327
AA Change: S221P

DomainStartEndE-ValueType
TBOX 1 82 3.3e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an embryonic nuclear transcription factor that binds to a specific DNA element, the palindromic T-site. It binds through a region in its N-terminus, called the T-box, and effects transcription of genes required for mesoderm formation and differentiation. The protein is localized to notochord-derived cells. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mice die during embryonice development. Heterozygous mice have skeletal abnormalities. On specific genetic backgrounds, some alleles cause partial or complete sex-reversal of chromosomally XY mice. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Targeted, other(2) Transgenic(1) Spontaneous(17) Chemically induced(10) Radiation induced(15)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in T
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:T APN 17 8437165 missense probably benign 0.01
IGL01155:T APN 17 8441745 unclassified probably null
IGL02343:T APN 17 8439900 splice site probably benign
IGL02626:T APN 17 8435237 missense probably damaging 0.99
IGL02628:T APN 17 8435358 missense probably damaging 1.00
IGL02970:T APN 17 8435385 missense probably damaging 0.97
I2289:T UTSW 17 8438642 missense probably benign
R0097:T UTSW 17 8439901 splice site probably benign
R0097:T UTSW 17 8439901 splice site probably benign
R1164:T UTSW 17 8439939 missense probably benign 0.00
R1993:T UTSW 17 8441802 missense probably benign 0.00
R5148:T UTSW 17 8436205 missense probably damaging 1.00
R5423:T UTSW 17 8441765 missense probably damaging 1.00
R6160:T UTSW 17 8441786 missense probably benign 0.00
R6196:T UTSW 17 8437164 missense possibly damaging 0.73
R6447:T UTSW 17 8441631 missense possibly damaging 0.50
RF010:T UTSW 17 8441708 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCACACTAAACAGTCACTGTG -3'
(R):5'- GTGTCATACTGGCTGTCAGAAATG -3'

Sequencing Primer
(F):5'- CTAAACAGTCACTGTGCTTATGGGC -3'
(R):5'- AAATGTCTGTGACTGTAGCAGCC -3'
Posted On2017-01-03