Incidental Mutation 'R5710:Cldn9'
ID452193
Institutional Source Beutler Lab
Gene Symbol Cldn9
Ensembl Gene ENSMUSG00000066720
Gene Nameclaudin 9
Synonymsnmf329
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23682584-23684018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23683447 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 68 (D68G)
Ref Sequence ENSEMBL: ENSMUSP00000093236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024699] [ENSMUST00000085989]
Predicted Effect probably benign
Transcript: ENSMUST00000024699
SMART Domains Protein: ENSMUSP00000024699
Gene: ENSMUSG00000023906

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 2.5e-35 PFAM
Pfam:Claudin_2 15 183 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085989
AA Change: D68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093236
Gene: ENSMUSG00000066720
AA Change: D68G

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 9.7e-35 PFAM
Pfam:Claudin_2 15 183 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is developmentally regulated; it is expressed in neonate kidney, but disappers by adulthood. It is required for the preservation of sensory cells in the hearing organ and the gene deficiency is associated with deafness. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit severe and early hearing loss associated with degeneration of outer hair cells and increased perilymph potassium ion concentration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Cldn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1687:Cldn9 UTSW 17 23683076 missense probably benign 0.00
R4195:Cldn9 UTSW 17 23683174 missense probably damaging 1.00
R6676:Cldn9 UTSW 17 23683049 missense probably benign 0.00
R7007:Cldn9 UTSW 17 23683078 missense probably benign
R7336:Cldn9 UTSW 17 23683015 missense probably benign 0.27
Z1177:Cldn9 UTSW 17 23683201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTGGATGATGGCATGG -3'
(R):5'- CTTGAACTCCTCGGCATGAC -3'

Sequencing Primer
(F):5'- ATGATGGCATGGGCTGTCC -3'
(R):5'- ATGACCCTGGCTGTGCTAG -3'
Posted On2017-01-03