Incidental Mutation 'R0552:Hsd17b12'
ID45220
Institutional Source Beutler Lab
Gene Symbol Hsd17b12
Ensembl Gene ENSMUSG00000027195
Gene Namehydroxysteroid (17-beta) dehydrogenase 12
Synonymskeratonectin, keratoadhesin, 2610510O05Rik, KIK-I
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location94032689-94157964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94043935 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 208 (F208I)
Ref Sequence ENSEMBL: ENSMUSP00000028619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028619]
Predicted Effect probably damaging
Transcript: ENSMUST00000028619
AA Change: F208I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028619
Gene: ENSMUSG00000027195
AA Change: F208I

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:adh_short 51 248 1.5e-46 PFAM
Pfam:KR 52 125 4.4e-7 PFAM
Pfam:adh_short_C2 57 277 7.5e-10 PFAM
low complexity region 298 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146580
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit die around E8.5 with abnormal embryonic and extraembryonic tissue development. ES cells heterozygous for this allele exhibit reduced arachidonic acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Hsd17b12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Hsd17b12 APN 2 94083165 critical splice donor site probably null
IGL00785:Hsd17b12 APN 2 94045414 missense probably damaging 1.00
IGL02230:Hsd17b12 APN 2 94045398 missense possibly damaging 0.94
IGL02635:Hsd17b12 APN 2 94083211 missense possibly damaging 0.93
IGL03094:Hsd17b12 APN 2 94033994 missense probably damaging 1.00
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0390:Hsd17b12 UTSW 2 94114990 splice site probably benign
R0605:Hsd17b12 UTSW 2 94033642 missense probably benign 0.00
R1585:Hsd17b12 UTSW 2 94033976 missense probably damaging 1.00
R1681:Hsd17b12 UTSW 2 94033561 missense unknown
R1922:Hsd17b12 UTSW 2 94045392 missense probably benign 0.00
R2190:Hsd17b12 UTSW 2 94034063 missense probably benign 0.02
R2384:Hsd17b12 UTSW 2 94033619 missense probably benign
R3123:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3124:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3125:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R4283:Hsd17b12 UTSW 2 94033586 missense unknown
R5218:Hsd17b12 UTSW 2 94083263 missense probably benign 0.02
R5357:Hsd17b12 UTSW 2 94033645 missense possibly damaging 0.47
R6020:Hsd17b12 UTSW 2 94033977 missense probably damaging 1.00
R6493:Hsd17b12 UTSW 2 94043883 missense probably damaging 1.00
R7792:Hsd17b12 UTSW 2 94033641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGCTCACGTCACAATCGCTTAC -3'
(R):5'- TGCATGGTTTCCAGGCAGTTTACAG -3'

Sequencing Primer
(F):5'- CGTCACAATCGCTTACTGAGG -3'
(R):5'- GCTGCACAGAATTCACTCTGG -3'
Posted On2013-06-11