Incidental Mutation 'R0552:Arsj'
ID45221
Institutional Source Beutler Lab
Gene Symbol Arsj
Ensembl Gene ENSMUSG00000046561
Gene Namearylsulfatase J
Synonyms9330196J05Rik
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location126363684-126440375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126439344 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 580 (R580G)
Ref Sequence ENSEMBL: ENSMUSP00000091511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093976]
Predicted Effect probably benign
Transcript: ENSMUST00000093976
AA Change: R580G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000091511
Gene: ENSMUSG00000046561
AA Change: R580G

DomainStartEndE-ValueType
Pfam:Sulfatase 74 388 8.4e-68 PFAM
low complexity region 554 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199285
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSJ, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Arsj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Arsj APN 3 126364945 missense probably benign 0.00
IGL01150:Arsj APN 3 126438784 missense probably benign
IGL01337:Arsj APN 3 126365114 missense probably damaging 1.00
IGL01446:Arsj APN 3 126438814 missense probably benign 0.01
IGL01484:Arsj APN 3 126365036 missense probably damaging 1.00
IGL02479:Arsj APN 3 126438939 missense possibly damaging 0.91
IGL03149:Arsj APN 3 126439404 utr 3 prime probably benign
R0690:Arsj UTSW 3 126438184 missense probably damaging 0.99
R1809:Arsj UTSW 3 126438295 missense possibly damaging 0.87
R1881:Arsj UTSW 3 126438837 missense probably damaging 1.00
R1940:Arsj UTSW 3 126438346 missense probably damaging 1.00
R1957:Arsj UTSW 3 126439021 missense probably benign 0.08
R2156:Arsj UTSW 3 126438688 missense probably damaging 1.00
R2969:Arsj UTSW 3 126439372 missense probably benign 0.01
R3432:Arsj UTSW 3 126364975 missense probably benign 0.00
R4623:Arsj UTSW 3 126364796 missense probably benign 0.00
R4826:Arsj UTSW 3 126438802 missense probably damaging 1.00
R4955:Arsj UTSW 3 126438540 missense probably benign 0.15
R5134:Arsj UTSW 3 126438154 missense probably benign
R5164:Arsj UTSW 3 126438159 missense probably benign 0.00
R5468:Arsj UTSW 3 126438388 missense possibly damaging 0.52
R5664:Arsj UTSW 3 126438657 missense probably damaging 1.00
R6136:Arsj UTSW 3 126364775 start codon destroyed probably null 0.07
R7030:Arsj UTSW 3 126439103 missense probably damaging 1.00
R7036:Arsj UTSW 3 126365000 missense probably damaging 0.99
R7064:Arsj UTSW 3 126438337 missense probably damaging 1.00
R7503:Arsj UTSW 3 126364844 missense probably benign
R7555:Arsj UTSW 3 126438236 nonsense probably null
X0022:Arsj UTSW 3 126364966 missense possibly damaging 0.52
Z1088:Arsj UTSW 3 126439132 missense possibly damaging 0.93
Z1177:Arsj UTSW 3 126438909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAACAAGACTGCCGTGCCTG -3'
(R):5'- GCAGAAGCATAGCCTTTGGCACAC -3'

Sequencing Primer
(F):5'- TGGGGTCCGTGGTATAAAGAG -3'
(R):5'- TCTCTGGCACAGAGCAATG -3'
Posted On2013-06-11