Incidental Mutation 'R0552:Txlna'
ID 45223
Institutional Source Beutler Lab
Gene Symbol Txlna
Ensembl Gene ENSMUSG00000053841
Gene Name taxilin alpha
Synonyms 2600010N21Rik, Txln, IL14
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R0552 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 129626078-129641065 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129629191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 452 (V452D)
Ref Sequence ENSEMBL: ENSMUSP00000081285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046425] [ENSMUST00000084264] [ENSMUST00000133803]
AlphaFold Q6PAM1
Predicted Effect probably benign
Transcript: ENSMUST00000046425
AA Change: V452D

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042153
Gene: ENSMUSG00000053841
AA Change: V452D

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 169 478 9.1e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084264
AA Change: V452D

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081285
Gene: ENSMUSG00000053841
AA Change: V452D

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 166 478 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133803
SMART Domains Protein: ENSMUSP00000117368
Gene: ENSMUSG00000053841

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 166 296 2.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Txlna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Txlna APN 4 129634365 unclassified probably benign
IGL01472:Txlna APN 4 129632115 missense probably damaging 0.99
IGL02169:Txlna APN 4 129629613 missense probably damaging 0.99
IGL02801:Txlna APN 4 129640408 missense probably damaging 1.00
R0010:Txlna UTSW 4 129629086 missense probably benign 0.30
R0010:Txlna UTSW 4 129629086 missense probably benign 0.30
R1961:Txlna UTSW 4 129640262 missense probably benign
R2215:Txlna UTSW 4 129639318 missense possibly damaging 0.89
R2279:Txlna UTSW 4 129632142 missense probably damaging 1.00
R5356:Txlna UTSW 4 129630373 missense probably damaging 1.00
R6354:Txlna UTSW 4 129634412 missense probably damaging 1.00
R7208:Txlna UTSW 4 129631278 critical splice donor site probably null
R7343:Txlna UTSW 4 129632160 missense probably damaging 1.00
R7615:Txlna UTSW 4 129630319 missense probably damaging 1.00
R7783:Txlna UTSW 4 129632157 missense probably damaging 1.00
R7784:Txlna UTSW 4 129632157 missense probably damaging 1.00
R8023:Txlna UTSW 4 129639485 missense probably damaging 0.98
R8331:Txlna UTSW 4 129639486 missense probably damaging 0.99
R9254:Txlna UTSW 4 129637107 missense probably damaging 1.00
R9321:Txlna UTSW 4 129634453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCCCATCCATGTAAGACTAAC -3'
(R):5'- ATCCAAGTGAGCCCTTTTGGGGAC -3'

Sequencing Primer
(F):5'- ATTCACAATTGCCAAGTGTCCG -3'
(R):5'- GTGGTCCTGTTTAACAATCGAC -3'
Posted On 2013-06-11