Incidental Mutation 'R5711:Idi2'
ID452232
Institutional Source Beutler Lab
Gene Symbol Idi2
Ensembl Gene ENSMUSG00000033520
Gene Nameisopentenyl-diphosphate delta isomerase 2
Synonyms4833405L16Rik
MMRRC Submission 043185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5711 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location8952863-8960945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8958482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000036621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038598]
Predicted Effect probably benign
Transcript: ENSMUST00000038598
AA Change: V92A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036621
Gene: ENSMUSG00000033520
AA Change: V92A

DomainStartEndE-ValueType
Pfam:NUDIX 50 199 2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104108
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 A T 13: 100,654,214 T18S probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap19 A G 19: 41,784,788 V275A possibly damaging Het
Cebpz T A 17: 78,934,611 Q538L probably damaging Het
Chgb A T 2: 132,792,698 I187F probably benign Het
Cldn1 C A 16: 26,371,417 L70F probably damaging Het
Crybg2 A T 4: 134,082,627 D1230V probably damaging Het
Csmd1 C T 8: 15,953,703 C2617Y probably damaging Het
D7Ertd443e T A 7: 134,349,381 N188Y probably benign Het
Ddx51 A G 5: 110,654,924 I214M probably benign Het
Dlg5 A G 14: 24,150,648 V1328A probably damaging Het
Dnah2 C T 11: 69,435,390 C3639Y probably damaging Het
Dync1i2 C T 2: 71,250,982 T511I probably benign Het
Fam220a A T 5: 143,563,457 E208V probably damaging Het
Gm11492 T C 11: 87,567,897 S366P probably benign Het
Gm4846 T C 1: 166,484,025 S422G probably benign Het
Grin2c C T 11: 115,250,289 R1001Q probably benign Het
H2-T3 T C 17: 36,187,409 E248G probably damaging Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Klhl26 T C 8: 70,452,324 D278G probably damaging Het
Mok G T 12: 110,808,069 T228K probably damaging Het
Olfr381 A G 11: 73,486,182 I214T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pabpc1 T C 15: 36,605,830 I101V probably benign Het
Ppargc1a G T 5: 51,474,220 Q356K probably damaging Het
Ptprt T A 2: 161,810,604 D608V probably damaging Het
Rxfp1 C T 3: 79,678,747 C96Y probably damaging Het
Scn11a A C 9: 119,789,924 V784G probably damaging Het
Slc12a8 A G 16: 33,590,309 Y226C probably damaging Het
Slc25a33 A G 4: 149,762,457 V49A possibly damaging Het
Slc25a45 T C 19: 5,884,423 S140P probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Spty2d1 G T 7: 46,998,097 N361K possibly damaging Het
Stk4 G A 2: 164,099,754 A297T probably benign Het
Thsd7b T A 1: 129,760,402 N683K probably damaging Het
Tln2 T C 9: 67,392,547 E141G probably benign Het
Tmem125 A T 4: 118,542,019 C72S probably damaging Het
Ttn G T 2: 76,742,093 T26152K probably damaging Het
Uhrf1 G A 17: 56,320,259 G643D possibly damaging Het
Vmn2r50 C T 7: 10,040,372 M532I possibly damaging Het
Other mutations in Idi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Idi2 APN 13 8958542 missense probably damaging 1.00
R1635:Idi2 UTSW 13 8959419 missense probably damaging 1.00
R3016:Idi2 UTSW 13 8959430 makesense probably null
R4854:Idi2 UTSW 13 8957843 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACAAGCATTTGTACCTGGAATTGAG -3'
(R):5'- GCCCTGAGTCAGCATTTTGG -3'

Sequencing Primer
(F):5'- GCATTTGTACCTGGAATTGAGTTATG -3'
(R):5'- GTGGATGAAACTTGATAGCACTGTC -3'
Posted On2017-01-03