Incidental Mutation 'R5711:Ak6'
ID452233
Institutional Source Beutler Lab
Gene Symbol Ak6
Ensembl Gene ENSMUSG00000078941
Gene Nameadenylate kinase 6
Synonyms2810046E22Rik, 4921516M08Rik
MMRRC Submission 043185-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5711 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100650979-100666359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100654214 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 18 (T18S)
Ref Sequence ENSEMBL: ENSMUSP00000140648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022135] [ENSMUST00000022136] [ENSMUST00000084721] [ENSMUST00000167256] [ENSMUST00000177848] [ENSMUST00000185767] [ENSMUST00000187792] [ENSMUST00000190165] [ENSMUST00000190594] [ENSMUST00000190729] [ENSMUST00000226050]
Predicted Effect probably benign
Transcript: ENSMUST00000022135
AA Change: T18S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022135
Gene: ENSMUSG00000078941
AA Change: T18S

DomainStartEndE-ValueType
Pfam:AAA_17 5 113 1.1e-13 PFAM
Pfam:AAA 6 45 3.6e-6 PFAM
Pfam:AAA_18 6 126 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022136
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084721
SMART Domains Protein: ENSMUSP00000081772
Gene: ENSMUSG00000078941

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167256
SMART Domains Protein: ENSMUSP00000132143
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 9 129 1.4e-52 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177848
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185767
SMART Domains Protein: ENSMUSP00000140423
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 2.2e-62 PFAM
Pfam:Bromo_TP 12 77 7.6e-5 PFAM
Pfam:CENP-S 15 80 5.7e-7 PFAM
Pfam:Histone 16 78 1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185901
Predicted Effect probably benign
Transcript: ENSMUST00000187792
SMART Domains Protein: ENSMUSP00000140051
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3e-62 PFAM
Pfam:CENP-S 15 80 6.9e-7 PFAM
Pfam:Histone 16 78 1.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190165
SMART Domains Protein: ENSMUSP00000139407
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3.8e-62 PFAM
Pfam:CENP-S 15 80 7.9e-7 PFAM
Pfam:Histone 16 78 1.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190210
Predicted Effect probably benign
Transcript: ENSMUST00000190594
SMART Domains Protein: ENSMUSP00000140244
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190729
AA Change: T18S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap19 A G 19: 41,784,788 V275A possibly damaging Het
Cebpz T A 17: 78,934,611 Q538L probably damaging Het
Chgb A T 2: 132,792,698 I187F probably benign Het
Cldn1 C A 16: 26,371,417 L70F probably damaging Het
Crybg2 A T 4: 134,082,627 D1230V probably damaging Het
Csmd1 C T 8: 15,953,703 C2617Y probably damaging Het
D7Ertd443e T A 7: 134,349,381 N188Y probably benign Het
Ddx51 A G 5: 110,654,924 I214M probably benign Het
Dlg5 A G 14: 24,150,648 V1328A probably damaging Het
Dnah2 C T 11: 69,435,390 C3639Y probably damaging Het
Dync1i2 C T 2: 71,250,982 T511I probably benign Het
Fam220a A T 5: 143,563,457 E208V probably damaging Het
Gm11492 T C 11: 87,567,897 S366P probably benign Het
Gm4846 T C 1: 166,484,025 S422G probably benign Het
Grin2c C T 11: 115,250,289 R1001Q probably benign Het
H2-T3 T C 17: 36,187,409 E248G probably damaging Het
Idi2 T C 13: 8,958,482 V92A probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Klhl26 T C 8: 70,452,324 D278G probably damaging Het
Mok G T 12: 110,808,069 T228K probably damaging Het
Olfr381 A G 11: 73,486,182 I214T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pabpc1 T C 15: 36,605,830 I101V probably benign Het
Ppargc1a G T 5: 51,474,220 Q356K probably damaging Het
Ptprt T A 2: 161,810,604 D608V probably damaging Het
Rxfp1 C T 3: 79,678,747 C96Y probably damaging Het
Scn11a A C 9: 119,789,924 V784G probably damaging Het
Slc12a8 A G 16: 33,590,309 Y226C probably damaging Het
Slc25a33 A G 4: 149,762,457 V49A possibly damaging Het
Slc25a45 T C 19: 5,884,423 S140P probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Spty2d1 G T 7: 46,998,097 N361K possibly damaging Het
Stk4 G A 2: 164,099,754 A297T probably benign Het
Thsd7b T A 1: 129,760,402 N683K probably damaging Het
Tln2 T C 9: 67,392,547 E141G probably benign Het
Tmem125 A T 4: 118,542,019 C72S probably damaging Het
Ttn G T 2: 76,742,093 T26152K probably damaging Het
Uhrf1 G A 17: 56,320,259 G643D possibly damaging Het
Vmn2r50 C T 7: 10,040,372 M532I possibly damaging Het
Other mutations in Ak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ak6 APN 13 100664091 missense probably benign 0.05
PIT4151001:Ak6 UTSW 13 100655095 missense probably damaging 0.98
R0189:Ak6 UTSW 13 100655142 missense probably damaging 1.00
R1716:Ak6 UTSW 13 100655669 missense probably benign
R1736:Ak6 UTSW 13 100655181 unclassified probably null
R4351:Ak6 UTSW 13 100655603 nonsense probably null
R4625:Ak6 UTSW 13 100655673 missense probably benign 0.00
R5690:Ak6 UTSW 13 100655621 unclassified probably null
R5870:Ak6 UTSW 13 100655424 missense probably damaging 1.00
R6018:Ak6 UTSW 13 100665951 nonsense probably null
R6386:Ak6 UTSW 13 100655803 unclassified probably benign
R7524:Ak6 UTSW 13 100663907 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTCCTATCCCTGGAGATTAG -3'
(R):5'- AGGATCCTTCTGCTTTCTGGAC -3'

Sequencing Primer
(F):5'- GTCCTGACACTGTGTAGCCTAG -3'
(R):5'- TCTGGACCTCTAGCAACACTTAG -3'
Posted On2017-01-03