Incidental Mutation 'R5722:Pik3c2b'
ID 452247
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms C330011J12Rik, PI3K-C2beta
MMRRC Submission 043340-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R5722 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 133045667-133108687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 133103836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 1505 (G1505W)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: G1505W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: G1505W

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133077396 missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133090034 missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133105081 missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 133066711 missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133079841 critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133085611 missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133102305 missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133100904 missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133103849 missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133075809 critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133090246 missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133088330 missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133090779 missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133077449 missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133084987 critical splice donor site probably null
R9621:Pik3c2b UTSW 1 133071607 missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133094749 missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133090850 missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133091600 missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133066553 missense probably damaging 1.00
Z1176:Pik3c2b UTSW 1 133099686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGCTATTCAGGTAGTGATGACC -3'
(R):5'- TGGTCACTCTCATTATCCAGGGG -3'

Sequencing Primer
(F):5'- ATTCAGGTAGTGATGACCCTATCCG -3'
(R):5'- TCTCATTATCCAGGGGCGGAG -3'
Posted On 2017-01-03