Incidental Mutation 'R5722:Olfr430'
List |< first << previous [record 25 of 51] next >> last >|
ID452248
Institutional Source Beutler Lab
Gene Symbol Olfr430
Ensembl Gene ENSMUSG00000050134
Gene Nameolfactory receptor 430
SynonymsGA_x6K02T2P20D-21108443-21107490, MOR105-5P
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174066605-174072273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 174069870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 191 (D191Y)
Ref Sequence ENSEMBL: ENSMUSP00000150930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055873] [ENSMUST00000213425] [ENSMUST00000214390]
Predicted Effect probably damaging
Transcript: ENSMUST00000055873
AA Change: D191Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130615
Gene: ENSMUSG00000050134
AA Change: D191Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-65 PFAM
Pfam:7tm_1 41 290 9.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213425
AA Change: D191Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214390
AA Change: D191Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Olfr430
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr430 APN 1 174070066 missense probably benign 0.00
IGL02279:Olfr430 APN 1 174069391 missense probably null 1.00
IGL02537:Olfr430 APN 1 174069454 missense possibly damaging 0.63
R0323:Olfr430 UTSW 1 174069327 missense probably benign
R0627:Olfr430 UTSW 1 174070077 missense probably damaging 1.00
R1079:Olfr430 UTSW 1 174069466 missense possibly damaging 0.95
R1757:Olfr430 UTSW 1 174069658 missense probably damaging 1.00
R1902:Olfr430 UTSW 1 174070126 missense probably damaging 0.96
R3804:Olfr430 UTSW 1 174069908 missense probably damaging 1.00
R3927:Olfr430 UTSW 1 174069312 missense probably damaging 1.00
R3930:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R3931:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R4111:Olfr430 UTSW 1 174069433 missense probably damaging 1.00
R4210:Olfr430 UTSW 1 174070008 missense probably damaging 0.98
R4383:Olfr430 UTSW 1 174069477 missense probably benign 0.34
R4651:Olfr430 UTSW 1 174069828 missense possibly damaging 0.54
R5097:Olfr430 UTSW 1 174069529 missense probably benign 0.22
R5385:Olfr430 UTSW 1 174069470 missense probably benign 0.31
R6608:Olfr430 UTSW 1 174069729 missense probably benign 0.00
R6643:Olfr430 UTSW 1 174070045 missense probably damaging 1.00
R7316:Olfr430 UTSW 1 174070161 missense probably benign 0.00
R7532:Olfr430 UTSW 1 174070098 missense probably benign 0.37
R8141:Olfr430 UTSW 1 174069922 missense probably damaging 0.99
Z1088:Olfr430 UTSW 1 174069949 missense probably damaging 1.00
Z1176:Olfr430 UTSW 1 174069331 missense probably damaging 1.00
Z1176:Olfr430 UTSW 1 174069514 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCGATACCTGGCCATCTGC -3'
(R):5'- TGCTCCCAAAGAAGATGAGCAC -3'

Sequencing Primer
(F):5'- TCCACTACCCTTCAATTATGACCAC -3'
(R):5'- CCAAAGAAGATGAGCACCACAATGAG -3'
Posted On2017-01-03