Incidental Mutation 'R5722:Actl6a'
ID452253
Institutional Source Beutler Lab
Gene Symbol Actl6a
Ensembl Gene ENSMUSG00000027671
Gene Nameactin-like 6A
Synonyms2810432C06Rik, Baf53a, ARP4, Actl6
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32706298-32726973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32718045 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 164 (R164H)
Ref Sequence ENSEMBL: ENSMUSP00000029214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029214] [ENSMUST00000126144] [ENSMUST00000193615] [ENSMUST00000194781]
Predicted Effect probably damaging
Transcript: ENSMUST00000029214
AA Change: R164H

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029214
Gene: ENSMUSG00000027671
AA Change: R164H

DomainStartEndE-ValueType
ACTIN 11 429 1.37e-189 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126144
AA Change: R112H

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114317
Gene: ENSMUSG00000027671
AA Change: R112H

DomainStartEndE-ValueType
ACTIN 1 204 4.28e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153779
Predicted Effect probably benign
Transcript: ENSMUST00000193231
Predicted Effect probably benign
Transcript: ENSMUST00000193615
SMART Domains Protein: ENSMUSP00000141354
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
Pfam:Actin 8 60 1.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194497
Predicted Effect probably benign
Transcript: ENSMUST00000194781
AA Change: R168H

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141543
Gene: ENSMUSG00000027671
AA Change: R168H

DomainStartEndE-ValueType
ACTIN 15 245 1.5e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E6.5. Mice homozygous for a conditional allele activated in hematopoietic cells exhibit bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Actl6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Actl6a APN 3 32712164 missense probably benign 0.01
IGL01691:Actl6a APN 3 32720200 missense possibly damaging 0.94
IGL02902:Actl6a APN 3 32722642 missense possibly damaging 0.93
R0194:Actl6a UTSW 3 32725320 missense probably damaging 1.00
R1193:Actl6a UTSW 3 32712144 missense probably benign 0.00
R1404:Actl6a UTSW 3 32722610 unclassified probably benign
R1754:Actl6a UTSW 3 32718574 missense probably damaging 1.00
R4289:Actl6a UTSW 3 32712114 missense possibly damaging 0.87
R5020:Actl6a UTSW 3 32720507 missense possibly damaging 0.79
R5165:Actl6a UTSW 3 32720208 missense probably benign 0.01
R5272:Actl6a UTSW 3 32718610 missense probably damaging 0.97
R5384:Actl6a UTSW 3 32720493 missense probably damaging 1.00
R5640:Actl6a UTSW 3 32718050 missense probably damaging 0.99
R5865:Actl6a UTSW 3 32712128 missense possibly damaging 0.80
R6208:Actl6a UTSW 3 32711894 missense probably benign 0.05
R7094:Actl6a UTSW 3 32706338 start gained probably benign
R7192:Actl6a UTSW 3 32720224 missense probably damaging 1.00
R7866:Actl6a UTSW 3 32712113 missense possibly damaging 0.87
R7949:Actl6a UTSW 3 32712113 missense possibly damaging 0.87
Z1176:Actl6a UTSW 3 32726543 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAACCATTCTGGGAGTCCTGC -3'
(R):5'- TACTTGGAAATGGATGTGCTCC -3'

Sequencing Primer
(F):5'- GCCTGTGCAAGTTCTTTTCAAGAC -3'
(R):5'- GATGTGCTCCAATAGAATTCCTGGTC -3'
Posted On2017-01-03