Incidental Mutation 'R5722:Sap25'
ID452258
Institutional Source Beutler Lab
Gene Symbol Sap25
Ensembl Gene ENSMUSG00000079165
Gene Namesin3 associated polypeptide
Synonyms25 kDa
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5722 (G1)
Quality Score146
Status Not validated
Chromosome5
Chromosomal Location137641334-137642902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137641451 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 13 (E13G)
Ref Sequence ENSEMBL: ENSMUSP00000135735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031734] [ENSMUST00000057314] [ENSMUST00000166099] [ENSMUST00000175968] [ENSMUST00000176667] [ENSMUST00000177466] [ENSMUST00000177477] [ENSMUST00000177545] [ENSMUST00000196511]
Predicted Effect probably benign
Transcript: ENSMUST00000031734
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057314
SMART Domains Protein: ENSMUSP00000060844
Gene: ENSMUSG00000047182

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166099
SMART Domains Protein: ENSMUSP00000127076
Gene: ENSMUSG00000079165

DomainStartEndE-ValueType
Pfam:SAP25 76 261 1.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175968
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176256
Predicted Effect probably benign
Transcript: ENSMUST00000176667
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176768
Predicted Effect probably benign
Transcript: ENSMUST00000176871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177354
Predicted Effect probably benign
Transcript: ENSMUST00000177466
AA Change: E13G

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000177477
SMART Domains Protein: ENSMUSP00000135724
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177545
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196511
SMART Domains Protein: ENSMUSP00000142730
Gene: ENSMUSG00000047182

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Sap25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Sap25 APN 5 137641818 critical splice donor site probably null
IGL02442:Sap25 APN 5 137641995 missense probably benign 0.02
IGL02651:Sap25 APN 5 137642370 missense possibly damaging 0.92
R1464:Sap25 UTSW 5 137642360 nonsense probably null
R1464:Sap25 UTSW 5 137642360 nonsense probably null
R1748:Sap25 UTSW 5 137641918 unclassified probably null
R2058:Sap25 UTSW 5 137642772 missense probably damaging 1.00
R2174:Sap25 UTSW 5 137642629 missense possibly damaging 0.73
R3768:Sap25 UTSW 5 137642370 missense probably damaging 0.97
R4920:Sap25 UTSW 5 137642245 unclassified probably benign
R7340:Sap25 UTSW 5 137642673 missense probably benign 0.11
R7775:Sap25 UTSW 5 137641924 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGTGGCTGAAGAAACGCTG -3'
(R):5'- TGCTGACCTGAGTTAGTCGC -3'

Sequencing Primer
(F):5'- CTGAAGAAACGCTGGCGCAG -3'
(R):5'- CTGAGTTAGTCGCAGGACCAAC -3'
Posted On2017-01-03