Incidental Mutation 'R5722:Kat8'
ID452266
Institutional Source Beutler Lab
Gene Symbol Kat8
Ensembl Gene ENSMUSG00000030801
Gene NameK(lysine) acetyltransferase 8
Synonyms5830450F21Rik, 2010203C02Rik, Myst1, MOF, D7Ertd629e
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127912516-127925837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127924816 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 343 (E343K)
Ref Sequence ENSEMBL: ENSMUSP00000033070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000033070] [ENSMUST00000205357] [ENSMUST00000206124] [ENSMUST00000206568]
PDB Structure
Solution Structure of the Tudor Domain from Mouse Hypothetical Protein Homologous to Histone Acetyltransferase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000032988
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033070
AA Change: E343K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033070
Gene: ENSMUSG00000030801
AA Change: E343K

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
CHROMO 69 123 6.6e-8 SMART
Blast:PHD 177 214 4e-6 BLAST
Pfam:MOZ_SAS 235 412 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205357
Predicted Effect probably benign
Transcript: ENSMUST00000206124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206364
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Meta Mutation Damage Score 0.8881 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYST histone acetylase protein family. The encoded protein has a characteristic MYST domain containing an acetyl-CoA-binding site, a chromodomain typical of proteins which bind histones, and a C2HC-type zinc finger. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele die prior to gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Kat8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Kat8 APN 7 127920504 missense probably damaging 1.00
R0853:Kat8 UTSW 7 127925224 missense probably benign 0.12
R1293:Kat8 UTSW 7 127922250 critical splice donor site probably null
R1926:Kat8 UTSW 7 127915295 nonsense probably null
R3824:Kat8 UTSW 7 127924482 missense possibly damaging 0.56
R4841:Kat8 UTSW 7 127925194 missense probably benign 0.11
R4892:Kat8 UTSW 7 127915538 missense possibly damaging 0.68
R5102:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5104:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5723:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5724:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5734:Kat8 UTSW 7 127920579 missense probably benign 0.00
R5820:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5821:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R7059:Kat8 UTSW 7 127924903 missense probably benign
R7158:Kat8 UTSW 7 127922159 missense probably benign
X0027:Kat8 UTSW 7 127925258 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AACGTGGCCTGCATCTTGAC -3'
(R):5'- TCCTTTAGGGTTCCAAGCG -3'

Sequencing Primer
(F):5'- GACCCTGCCTCCCTACCAG -3'
(R):5'- AGGGTTCCAAGCGATCCTTCAC -3'
Posted On2017-01-03