Incidental Mutation 'R5722:Tox3'
List |< first << previous [record 44 of 51] next >> last >|
ID452271
Institutional Source Beutler Lab
Gene Symbol Tox3
Ensembl Gene ENSMUSG00000043668
Gene NameTOX high mobility group box family member 3
SynonymsCAGF9, Tnrc9, 500-9
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R5722 (G1)
Quality Score121
Status Not validated
Chromosome8
Chromosomal Location90247040-90348343 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 90347861 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109621] [ENSMUST00000176034] [ENSMUST00000176616]
Predicted Effect probably null
Transcript: ENSMUST00000109621
SMART Domains Protein: ENSMUSP00000105250
Gene: ENSMUSG00000043668

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
HMG 253 323 2.93e-19 SMART
low complexity region 345 362 N/A INTRINSIC
coiled coil region 438 466 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176034
SMART Domains Protein: ENSMUSP00000134931
Gene: ENSMUSG00000043668

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176616
SMART Domains Protein: ENSMUSP00000135697
Gene: ENSMUSG00000043668

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 194 213 N/A INTRINSIC
HMG 252 309 1.29e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an HMG-box, indicating that it may be involved in bending and unwinding of DNA and alteration of chromatin structure. The C-terminus of the encoded protein is glutamine-rich due to CAG repeats in the coding sequence. A minor allele of this gene has been implicated in an elevated risk of breast cancer. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Tox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Tox3 APN 8 90270434 missense probably damaging 1.00
IGL02417:Tox3 APN 8 90258131 missense possibly damaging 0.52
IGL02447:Tox3 APN 8 90258153 splice site probably benign
R1139:Tox3 UTSW 8 90248869 missense probably damaging 1.00
R1472:Tox3 UTSW 8 90254345 missense probably damaging 1.00
R1892:Tox3 UTSW 8 90270241 missense probably benign 0.31
R1906:Tox3 UTSW 8 90248429 unclassified probably benign
R2847:Tox3 UTSW 8 90248390 nonsense probably null
R2849:Tox3 UTSW 8 90248390 nonsense probably null
R3703:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R3705:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R4984:Tox3 UTSW 8 90248642 unclassified probably benign
R5249:Tox3 UTSW 8 90248816 missense probably benign 0.09
R6291:Tox3 UTSW 8 90248938 missense probably damaging 1.00
R6451:Tox3 UTSW 8 90258059 missense probably benign 0.31
R7653:Tox3 UTSW 8 90248989 missense probably damaging 1.00
R7753:Tox3 UTSW 8 90248932 missense probably damaging 1.00
R8061:Tox3 UTSW 8 90248642 unclassified probably benign
R8220:Tox3 UTSW 8 90258080 missense not run
Predicted Primers PCR Primer
(F):5'- GCTTCACACAGCTTTTAGGG -3'
(R):5'- TCCTCGACGGTGGATCGTAC -3'

Sequencing Primer
(F):5'- TCACACAGCTTTTAGGGGGAGC -3'
(R):5'- GGTGGATCGTACGGCCG -3'
Posted On2017-01-03