Incidental Mutation 'R5722:Ces1d'
List |< first << previous [record 9 of 51] next >> last >|
ID452272
Institutional Source Beutler Lab
Gene Symbol Ces1d
Ensembl Gene ENSMUSG00000056973
Gene Namecarboxylesterase 1D
SynonymsTGH, Ces3
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93166068-93197838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93178128 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 328 (P328L)
Ref Sequence ENSEMBL: ENSMUSP00000034172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034172]
Predicted Effect probably benign
Transcript: ENSMUST00000034172
AA Change: P328L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000034172
Gene: ENSMUSG00000056973
AA Change: P328L

DomainStartEndE-ValueType
Pfam:COesterase 1 545 4.9e-169 PFAM
Pfam:Abhydrolase_3 136 256 8.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148340
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased blood lipids, improved glucose tolerance, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Ces1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Ces1d APN 8 93195089 splice site probably benign
IGL01707:Ces1d APN 8 93189550 missense possibly damaging 0.57
IGL01753:Ces1d APN 8 93192810 missense probably damaging 1.00
IGL01918:Ces1d APN 8 93178075 missense probably benign 0.00
IGL02730:Ces1d APN 8 93186016 missense probably benign
IGL02819:Ces1d APN 8 93169718 splice site probably null
IGL02824:Ces1d APN 8 93169718 splice site probably null
IGL02825:Ces1d APN 8 93169718 splice site probably null
IGL02858:Ces1d APN 8 93169718 splice site probably null
IGL02877:Ces1d APN 8 93169718 splice site probably null
IGL02946:Ces1d APN 8 93169718 splice site probably null
IGL02990:Ces1d APN 8 93169718 splice site probably null
IGL03024:Ces1d APN 8 93169718 splice site probably null
IGL03080:Ces1d APN 8 93169718 splice site probably null
IGL03081:Ces1d APN 8 93169718 splice site probably null
IGL03082:Ces1d APN 8 93169718 splice site probably null
IGL03096:Ces1d APN 8 93178042 missense probably benign 0.01
IGL03165:Ces1d APN 8 93189519 missense probably benign 0.02
IGL03233:Ces1d APN 8 93195079 missense probably benign
IGL03263:Ces1d APN 8 93169718 splice site probably null
IGL03310:Ces1d APN 8 93175188 splice site probably benign
IGL03338:Ces1d APN 8 93169718 splice site probably null
IGL03357:Ces1d APN 8 93169718 splice site probably null
R0125:Ces1d UTSW 8 93175182 splice site probably benign
R0393:Ces1d UTSW 8 93192772 missense probably damaging 1.00
R0483:Ces1d UTSW 8 93197679 missense probably benign
R0746:Ces1d UTSW 8 93189468 missense probably damaging 1.00
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1607:Ces1d UTSW 8 93186118 missense probably benign 0.08
R1879:Ces1d UTSW 8 93189498 missense probably benign 0.35
R2881:Ces1d UTSW 8 93195031 missense probably damaging 1.00
R3870:Ces1d UTSW 8 93175086 missense probably benign 0.15
R4004:Ces1d UTSW 8 93178092 missense probably benign 0.03
R4573:Ces1d UTSW 8 93181534 missense probably benign 0.00
R4647:Ces1d UTSW 8 93166410 missense probably damaging 1.00
R4985:Ces1d UTSW 8 93175144 missense possibly damaging 0.61
R5080:Ces1d UTSW 8 93181547 missense probably benign 0.02
R5209:Ces1d UTSW 8 93175188 splice site probably benign
R5351:Ces1d UTSW 8 93178078 missense probably damaging 1.00
R5433:Ces1d UTSW 8 93186036 missense probably benign 0.02
R5614:Ces1d UTSW 8 93176204 missense probably benign 0.00
R6257:Ces1d UTSW 8 93166397 missense probably benign 0.03
R7238:Ces1d UTSW 8 93178135 missense probably benign 0.01
R7410:Ces1d UTSW 8 93192805 missense probably damaging 1.00
R7489:Ces1d UTSW 8 93178131 missense probably damaging 1.00
R7563:Ces1d UTSW 8 93178039 missense probably benign 0.25
R7827:Ces1d UTSW 8 93197666 critical splice donor site probably null
R7853:Ces1d UTSW 8 93175067 missense probably benign 0.29
R7860:Ces1d UTSW 8 93171137 missense probably benign 0.08
R7936:Ces1d UTSW 8 93175067 missense probably benign 0.29
R7943:Ces1d UTSW 8 93171137 missense probably benign 0.08
RF014:Ces1d UTSW 8 93176165 critical splice donor site probably null
Z1088:Ces1d UTSW 8 93175108 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAAACCTTGGTCAGAGCAGGG -3'
(R):5'- CCATCATCTTGGTGGCACTG -3'

Sequencing Primer
(F):5'- GAGCATGATGGCTGAACCTCTG -3'
(R):5'- GGTGGCACTGACTCCTTAAAGAATC -3'
Posted On2017-01-03