Incidental Mutation 'R5722:Stat6'
List |< first << previous [record 40 of 51] next >> last >|
ID452278
Institutional Source Beutler Lab
Gene Symbol Stat6
Ensembl Gene ENSMUSG00000002147
Gene Namesignal transducer and activator of transcription 6
Synonyms
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127642986-127660957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127658373 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 658 (T658A)
Ref Sequence ENSEMBL: ENSMUSP00000089708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157]
Predicted Effect probably benign
Transcript: ENSMUST00000026469
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092074
AA Change: T658A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147
AA Change: T658A

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099157
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156231
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Stat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Stat6 APN 10 127654932 missense probably damaging 1.00
IGL01785:Stat6 APN 10 127657227 missense probably damaging 1.00
IGL02939:Stat6 APN 10 127646940 missense probably benign 0.05
IGL03266:Stat6 APN 10 127657155 missense possibly damaging 0.88
IGL03412:Stat6 APN 10 127658205 missense probably benign 0.00
Rigid UTSW 10 127658702 critical splice donor site probably null
Stationary UTSW 10 127652222 missense possibly damaging 0.93
PIT4142001:Stat6 UTSW 10 127658230 missense possibly damaging 0.95
R0165:Stat6 UTSW 10 127657227 missense probably damaging 0.98
R0581:Stat6 UTSW 10 127648116 missense probably damaging 0.99
R0735:Stat6 UTSW 10 127658241 missense probably damaging 1.00
R1333:Stat6 UTSW 10 127651225 missense possibly damaging 0.62
R1352:Stat6 UTSW 10 127650811 missense probably benign 0.32
R1457:Stat6 UTSW 10 127658245 missense probably damaging 0.98
R1538:Stat6 UTSW 10 127653256 missense probably damaging 1.00
R1696:Stat6 UTSW 10 127653049 missense probably damaging 1.00
R2016:Stat6 UTSW 10 127650796 missense probably damaging 1.00
R3236:Stat6 UTSW 10 127652222 missense possibly damaging 0.93
R3980:Stat6 UTSW 10 127655379 missense probably damaging 1.00
R4467:Stat6 UTSW 10 127651228 missense probably damaging 1.00
R5346:Stat6 UTSW 10 127652313 missense probably benign 0.44
R5481:Stat6 UTSW 10 127647826 splice site probably null
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6244:Stat6 UTSW 10 127657712 splice site probably null
R6914:Stat6 UTSW 10 127651262 missense probably damaging 1.00
R6937:Stat6 UTSW 10 127658702 critical splice donor site probably null
R6942:Stat6 UTSW 10 127651262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGCAGTGGGATACTC -3'
(R):5'- TCTGAAAAGGCCAGCTTGC -3'

Sequencing Primer
(F):5'- TGGGATACTCCACAGTTCTCC -3'
(R):5'- CAGCTTGCTCGGCCGAC -3'
Posted On2017-01-03