Incidental Mutation 'R5722:Asic2'
List |< first << previous [record 7 of 51] next >> last >|
ID452280
Institutional Source Beutler Lab
Gene Symbol Asic2
Ensembl Gene ENSMUSG00000020704
Gene Nameacid-sensing (proton-gated) ion channel 2
SynonymsMdeg, BNC1, BNaC1a, Accn1
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location80880169-81968457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81967980 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 69 (S69T)
Ref Sequence ENSEMBL: ENSMUSP00000067095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066197]
Predicted Effect probably benign
Transcript: ENSMUST00000066197
AA Change: S69T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067095
Gene: ENSMUSG00000020704
AA Change: S69T

DomainStartEndE-ValueType
Pfam:ASC 20 454 3.3e-177 PFAM
low complexity region 456 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mechanoreceptor and spiral ganglion electrophysiology and decreased pressure-induced blood vessel constriction. Mice homozygous for a different knock-out allele exhibit retinal degeneration and abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Asic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Asic2 APN 11 80894030 missense probably damaging 0.99
IGL02420:Asic2 APN 11 80881653 missense probably benign 0.05
IGL02451:Asic2 APN 11 80891737 splice site probably benign
LCD18:Asic2 UTSW 11 80985744 intron probably benign
R0682:Asic2 UTSW 11 80886680 missense possibly damaging 0.67
R0718:Asic2 UTSW 11 80971456 splice site probably benign
R0784:Asic2 UTSW 11 80893989 missense possibly damaging 0.92
R2679:Asic2 UTSW 11 81151954 missense probably benign 0.13
R2883:Asic2 UTSW 11 80894013 missense possibly damaging 0.61
R2991:Asic2 UTSW 11 81968037 missense probably benign
R4722:Asic2 UTSW 11 81968183 start codon destroyed probably null 0.00
R4770:Asic2 UTSW 11 80971492 missense probably benign 0.07
R4900:Asic2 UTSW 11 81573454 intron probably benign
R5005:Asic2 UTSW 11 80883426 missense probably damaging 1.00
R5056:Asic2 UTSW 11 80971603 missense possibly damaging 0.64
R5344:Asic2 UTSW 11 80971587 missense probably damaging 1.00
R5490:Asic2 UTSW 11 80889820 missense probably benign 0.02
R6072:Asic2 UTSW 11 80894088 missense probably damaging 0.97
R6589:Asic2 UTSW 11 80886604 missense possibly damaging 0.79
R7068:Asic2 UTSW 11 81152255 missense probably benign 0.01
R7226:Asic2 UTSW 11 80971514 missense probably damaging 1.00
R7593:Asic2 UTSW 11 81967831 missense probably benign 0.01
R7869:Asic2 UTSW 11 81967998 missense probably damaging 1.00
R7952:Asic2 UTSW 11 81967998 missense probably damaging 1.00
Z1176:Asic2 UTSW 11 80889832 missense possibly damaging 0.55
Z1176:Asic2 UTSW 11 81967670 missense probably benign 0.05
Z1177:Asic2 UTSW 11 80894011 missense possibly damaging 0.76
Z1177:Asic2 UTSW 11 81152090 missense probably benign 0.00
Z1177:Asic2 UTSW 11 81152240 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAGGAATCTGCAAGTTGACATC -3'
(R):5'- CCTGAAGCCAGTTGCAGAAC -3'

Sequencing Primer
(F):5'- TTGACATCCAACAGGGCCAG -3'
(R):5'- TCCCGATGGACCTCAAGGAGAG -3'
Posted On2017-01-03