Incidental Mutation 'R5722:Sp4'
List |< first << previous [record 38 of 51] next >> last >|
ID452283
Institutional Source Beutler Lab
Gene Symbol Sp4
Ensembl Gene ENSMUSG00000025323
Gene Nametrans-acting transcription factor 4
Synonyms5730497N03Rik, HF1-b, HF-1b
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118234933-118301440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118299241 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 357 (I357F)
Ref Sequence ENSEMBL: ENSMUSP00000152603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026367] [ENSMUST00000221844] [ENSMUST00000222314]
Predicted Effect probably benign
Transcript: ENSMUST00000026367
AA Change: I357F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000026367
Gene: ENSMUSG00000025323
AA Change: I357F

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 146 N/A INTRINSIC
internal_repeat_1 157 255 4.15e-6 PROSPERO
internal_repeat_2 203 265 5.92e-5 PROSPERO
low complexity region 272 296 N/A INTRINSIC
low complexity region 300 342 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
low complexity region 392 421 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
internal_repeat_2 451 506 5.92e-5 PROSPERO
internal_repeat_1 461 539 4.15e-6 PROSPERO
low complexity region 540 549 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
low complexity region 629 638 N/A INTRINSIC
ZnF_C2H2 645 669 2.82e0 SMART
ZnF_C2H2 675 699 7.37e-4 SMART
ZnF_C2H2 705 727 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221844
Predicted Effect possibly damaging
Transcript: ENSMUST00000222314
AA Change: I357F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can bind to the GC promoter region of a variety of genes, including those of the photoreceptor signal transduction system. The encoded protein binds to the same sites in promoter CpG islands as does the transcription factor SP1, although its expression is much more restricted compared to that of SP1. This gene may be involved in bipolar disorder and schizophrenia. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac arrhythmias and most die shortly after birth. Surviving males complete spermatogenesis but do not copulate, while females show delayed sexual maturation and reduction in spleen, thymus, and uterus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Sp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Sp4 APN 12 118299549 missense probably damaging 0.99
IGL02817:Sp4 APN 12 118299552 missense probably damaging 1.00
IGL02833:Sp4 APN 12 118261881 missense probably benign 0.05
Speck UTSW 12 118300811 splice site probably null
R0128:Sp4 UTSW 12 118300816 splice site probably benign
R0130:Sp4 UTSW 12 118300816 splice site probably benign
R0398:Sp4 UTSW 12 118298673 missense possibly damaging 0.79
R0626:Sp4 UTSW 12 118299579 missense probably damaging 1.00
R1193:Sp4 UTSW 12 118299246 missense possibly damaging 0.94
R1775:Sp4 UTSW 12 118299600 missense probably damaging 0.99
R4724:Sp4 UTSW 12 118261809 missense probably benign
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4969:Sp4 UTSW 12 118299606 missense probably damaging 0.96
R5049:Sp4 UTSW 12 118254472 missense probably benign 0.04
R5178:Sp4 UTSW 12 118261889 missense possibly damaging 0.46
R5208:Sp4 UTSW 12 118299546 missense probably damaging 1.00
R6318:Sp4 UTSW 12 118238178 missense probably damaging 1.00
R6619:Sp4 UTSW 12 118299342 missense possibly damaging 0.92
R6917:Sp4 UTSW 12 118299173 missense probably damaging 1.00
R7195:Sp4 UTSW 12 118300072 missense possibly damaging 0.92
R7614:Sp4 UTSW 12 118254439 missense possibly damaging 0.82
R7747:Sp4 UTSW 12 118254404 splice site probably null
Z1177:Sp4 UTSW 12 118300059 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATTGTCTGCCCTGACTGGAG -3'
(R):5'- TAGTTTCTACGCCCACCACCAG -3'

Sequencing Primer
(F):5'- CCCTGACTGGAGCTGAAATGAC -3'
(R):5'- AGCACTGCTCCCGCCAG -3'
Posted On2017-01-03