Incidental Mutation 'R5722:Thoc3'
ID452285
Institutional Source Beutler Lab
Gene Symbol Thoc3
Ensembl Gene ENSMUSG00000025872
Gene NameTHO complex 3
Synonyms
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54458837-54468849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54460201 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 310 (T310N)
Ref Sequence ENSEMBL: ENSMUSP00000026990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026990]
Predicted Effect probably damaging
Transcript: ENSMUST00000026990
AA Change: T310N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026990
Gene: ENSMUSG00000025872
AA Change: T310N

DomainStartEndE-ValueType
WD40 44 83 3.1e-8 SMART
WD40 88 128 1.3e-11 SMART
WD40 131 169 1.7e-3 SMART
Blast:WD40 172 210 1e-16 BLAST
WD40 213 252 3.8e-10 SMART
WD40 255 294 1.1e-3 SMART
WD40 297 346 1.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151158
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nuclear THO transcription elongation complex, which is part of the larger transcription export (TREX) complex that couples messenger RNA processing and export. In humans, the transcription export complex is recruited to the 5'-end of messenger RNAs in a splicing- and cap-dependent manner. Studies of a related complex in mouse suggest that the metazoan transcription export complex is involved in cell differentiation and development. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Thoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Thoc3 APN 13 54467820 splice site probably benign
IGL02811:Thoc3 APN 13 54460175 missense probably benign 0.24
IGL03210:Thoc3 APN 13 54466222 missense probably benign 0.00
R1512:Thoc3 UTSW 13 54466178 critical splice donor site probably null
R2252:Thoc3 UTSW 13 54467833 missense probably benign 0.00
R4133:Thoc3 UTSW 13 54468548 missense probably benign 0.16
R5686:Thoc3 UTSW 13 54467873 missense probably damaging 0.99
R6225:Thoc3 UTSW 13 54467972 missense probably benign 0.04
R7088:Thoc3 UTSW 13 54463752 missense probably damaging 1.00
R7098:Thoc3 UTSW 13 54466306 missense probably damaging 0.98
R7662:Thoc3 UTSW 13 54463804 missense probably damaging 1.00
R7778:Thoc3 UTSW 13 54463778 missense probably damaging 1.00
R7824:Thoc3 UTSW 13 54463778 missense probably damaging 1.00
Z1177:Thoc3 UTSW 13 54460186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTAGCCCAAATAGTCCGC -3'
(R):5'- TTCAGTAAGGACAGGCTGTCTG -3'

Sequencing Primer
(F):5'- AAATAGTCCGCCCGGCCTC -3'
(R):5'- CAGGCTGTCTGTAAGGTGC -3'
Posted On2017-01-03