Incidental Mutation 'R5722:Smgc'
ID452289
Institutional Source Beutler Lab
Gene Symbol Smgc
Ensembl Gene ENSMUSG00000047295
Gene Namesubmandibular gland protein C
SynonymsSfc21, DXImx49e, 2310010P21Rik
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location91838265-91861438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91841906 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 18 (S18R)
Ref Sequence ENSEMBL: ENSMUSP00000118530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088555] [ENSMUST00000100293] [ENSMUST00000109276] [ENSMUST00000109277] [ENSMUST00000126508] [ENSMUST00000130014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088555
AA Change: S64R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085915
Gene: ENSMUSG00000047295
AA Change: S64R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_1 55 224 2.76e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 2.76e-22 PROSPERO
low complexity region 563 574 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 652 667 N/A INTRINSIC
low complexity region 677 701 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100293
AA Change: S64R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097866
Gene: ENSMUSG00000047295
AA Change: S64R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_2 32 180 5.58e-9 PROSPERO
internal_repeat_1 55 224 1.24e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 1.24e-22 PROSPERO
internal_repeat_2 420 569 5.58e-9 PROSPERO
low complexity region 576 593 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 644 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109276
SMART Domains Protein: ENSMUSP00000104899
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109277
SMART Domains Protein: ENSMUSP00000104900
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
low complexity region 72 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123935
Predicted Effect possibly damaging
Transcript: ENSMUST00000126508
AA Change: S20R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120826
Gene: ENSMUSG00000047295
AA Change: S20R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130014
AA Change: S18R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118530
Gene: ENSMUSG00000047295
AA Change: S18R

DomainStartEndE-ValueType
internal_repeat_1 113 156 5.82e-16 PROSPERO
low complexity region 179 189 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
internal_repeat_1 233 276 5.82e-16 PROSPERO
low complexity region 304 319 N/A INTRINSIC
low complexity region 329 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136172
SMART Domains Protein: ENSMUSP00000119575
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 201 218 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Smgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Smgc APN 15 91854543 splice site probably benign
IGL00835:Smgc APN 15 91844420 missense probably damaging 0.99
IGL01651:Smgc APN 15 91859788 intron probably benign
IGL01669:Smgc APN 15 91860684 missense possibly damaging 0.89
IGL01743:Smgc APN 15 91854593 missense probably benign 0.19
IGL01898:Smgc APN 15 91844524 splice site probably null
IGL03152:Smgc APN 15 91841422 missense possibly damaging 0.66
IGL03172:Smgc APN 15 91860444 missense probably damaging 0.99
IGL03352:Smgc APN 15 91860678 missense probably damaging 0.96
IGL03385:Smgc APN 15 91841978 missense possibly damaging 0.66
K7371:Smgc UTSW 15 91860255 splice site probably benign
R0090:Smgc UTSW 15 91859762 missense possibly damaging 0.91
R0125:Smgc UTSW 15 91854543 splice site probably benign
R0386:Smgc UTSW 15 91854638 missense probably benign 0.07
R0684:Smgc UTSW 15 91841467 unclassified probably benign
R1187:Smgc UTSW 15 91860600 missense probably damaging 0.99
R1586:Smgc UTSW 15 91838393 missense possibly damaging 0.90
R1848:Smgc UTSW 15 91859758 missense possibly damaging 0.58
R1964:Smgc UTSW 15 91860270 missense probably damaging 1.00
R2144:Smgc UTSW 15 91844421 missense possibly damaging 0.81
R3499:Smgc UTSW 15 91842003 missense possibly damaging 0.66
R3842:Smgc UTSW 15 91860262 splice site probably benign
R3978:Smgc UTSW 15 91860348 missense probably damaging 0.99
R4173:Smgc UTSW 15 91860561 missense possibly damaging 0.95
R4692:Smgc UTSW 15 91854561 missense possibly damaging 0.46
R4761:Smgc UTSW 15 91845514 missense possibly damaging 0.66
R4794:Smgc UTSW 15 91841454 missense probably benign 0.27
R4801:Smgc UTSW 15 91854616 missense probably benign 0.01
R4802:Smgc UTSW 15 91854616 missense probably benign 0.01
R5621:Smgc UTSW 15 91844420 missense probably damaging 0.99
R5672:Smgc UTSW 15 91841905 missense possibly damaging 0.46
R5707:Smgc UTSW 15 91860663 missense possibly damaging 0.66
R6212:Smgc UTSW 15 91850627 intron probably benign
R6767:Smgc UTSW 15 91841398 missense possibly damaging 0.46
R7049:Smgc UTSW 15 91860378 missense possibly damaging 0.82
R7155:Smgc UTSW 15 91852608 missense possibly damaging 0.66
R7210:Smgc UTSW 15 91860294 missense probably damaging 0.99
R7448:Smgc UTSW 15 91845493 missense probably benign 0.02
R7474:Smgc UTSW 15 91860694 missense possibly damaging 0.92
R7890:Smgc UTSW 15 91847076 missense possibly damaging 0.46
R7973:Smgc UTSW 15 91847076 missense possibly damaging 0.46
R8115:Smgc UTSW 15 91849119 critical splice donor site probably null
Z1177:Smgc UTSW 15 91856621 missense unknown
Z1177:Smgc UTSW 15 91856626 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAGAAAGGTTCTGATGTTGGC -3'
(R):5'- AGTCCCGGTAGAATACCTCCTAC -3'

Sequencing Primer
(F):5'- GGCTTTGGAATTTATAGCTTGAATTC -3'
(R):5'- GTAGAATACCTCCTACTCTGGGCAG -3'
Posted On2017-01-03