Incidental Mutation 'R5722:Tmem8'
ID452292
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5722 (G1)
Quality Score135
Status Not validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGGGG to CGGGGG at 26120562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect probably null
Transcript: ENSMUST00000025010
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably null
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 unclassified probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3609:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5098:Tmem8 UTSW 17 26118928 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5640:Tmem8 UTSW 17 26118872 missense possibly damaging 0.50
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6587:Tmem8 UTSW 17 26121564 missense probably benign 0.03
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R7771:Tmem8 UTSW 17 26122073 missense probably damaging 1.00
R8037:Tmem8 UTSW 17 26117535 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCACGCTCAGCAACCTCATG -3'
(R):5'- CTCTGCCACGTCATGTACTG -3'

Sequencing Primer
(F):5'- AGCAACCTCATGTTCCTGG -3'
(R):5'- CCACGTCATGTACTGTATGTGAG -3'
Posted On2017-01-03