Incidental Mutation 'R5722:Pgap6'
ID 452292
Institutional Source Beutler Lab
Gene Symbol Pgap6
Ensembl Gene ENSMUSG00000024180
Gene Name post-glycosylphosphatidylinositol attachment to proteins 6
Synonyms Rxylt1, Tmem8, M83
MMRRC Submission 043340-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R5722 (G1)
Quality Score 135
Status Not validated
Chromosome 17
Chromosomal Location 26332290-26342228 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CGGGG to CGGGGG at 26339536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
AlphaFold Q9ESN3
Predicted Effect probably null
Transcript: ENSMUST00000025010
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably null
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,772,194 (GRCm39) R164H probably damaging Het
Afg3l2 A G 18: 67,573,269 (GRCm39) Y178H probably benign Het
Agtr1a A G 13: 30,566,016 (GRCm39) *360W probably null Het
Arfgef1 A G 1: 10,209,109 (GRCm39) V1830A probably benign Het
Asic2 A T 11: 81,858,806 (GRCm39) S69T probably benign Het
Axin1 A T 17: 26,401,531 (GRCm39) N368Y probably damaging Het
Brme1 A G 8: 84,898,473 (GRCm39) E537G probably damaging Het
Ces1d G A 8: 93,904,756 (GRCm39) P328L probably benign Het
Cndp2 T A 18: 84,686,203 (GRCm39) K461* probably null Het
Cntnap5c A T 17: 58,620,852 (GRCm39) H977L probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Glg1 T C 8: 111,896,194 (GRCm39) T177A possibly damaging Het
Gm7168 T C 17: 14,169,824 (GRCm39) V397A probably benign Het
Hif1a T A 12: 73,988,533 (GRCm39) D535E probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ice1 T C 13: 70,763,219 (GRCm39) E173G possibly damaging Het
Ighmbp2 A G 19: 3,329,909 (GRCm39) V115A probably damaging Het
Irf2 A T 8: 47,271,831 (GRCm39) E101D possibly damaging Het
Kat8 G A 7: 127,523,988 (GRCm39) E343K probably damaging Het
Kyat1 C T 2: 30,078,123 (GRCm39) C127Y probably damaging Het
Mrgpra4 T C 7: 47,630,755 (GRCm39) H282R probably benign Het
Npsr1 C A 9: 24,225,096 (GRCm39) P368Q probably damaging Het
Nwd1 G A 8: 73,401,872 (GRCm39) V839M probably damaging Het
Or51a43 T A 7: 103,717,930 (GRCm39) M103L probably damaging Het
Or6n2 G T 1: 173,897,436 (GRCm39) D191Y probably damaging Het
P4ha3 A G 7: 99,955,198 (GRCm39) D351G probably benign Het
Pard3b T A 1: 62,479,160 (GRCm39) probably null Het
Pik3c2b G T 1: 133,031,574 (GRCm39) G1505W probably damaging Het
Plppr5 A T 3: 117,414,714 (GRCm39) I112L probably benign Het
Potefam1 T A 2: 111,034,468 (GRCm39) T355S probably benign Het
Ptprq A G 10: 107,522,226 (GRCm39) I575T possibly damaging Het
Ranbp3l A G 15: 9,029,656 (GRCm39) E46G probably damaging Het
Rbm46 A G 3: 82,772,640 (GRCm39) V164A possibly damaging Het
Sap25 A G 5: 137,639,713 (GRCm39) E13G probably benign Het
Setbp1 A T 18: 78,899,860 (GRCm39) V1269E possibly damaging Het
Smgc T A 15: 91,726,109 (GRCm39) S18R possibly damaging Het
Snrk T C 9: 121,993,072 (GRCm39) I345T probably benign Het
Sp4 T A 12: 118,262,976 (GRCm39) I357F possibly damaging Het
Sra1 A G 18: 36,808,031 (GRCm39) L399P probably damaging Het
Stat6 A G 10: 127,494,242 (GRCm39) T658A probably benign Het
Sv2a G A 3: 96,092,339 (GRCm39) R13H probably benign Het
Thoc3 G T 13: 54,608,014 (GRCm39) T310N probably damaging Het
Tox3 A C 8: 91,074,489 (GRCm39) probably null Het
Trpc6 A G 9: 8,680,550 (GRCm39) E848G possibly damaging Het
Ttn T A 2: 76,538,590 (GRCm39) T34703S possibly damaging Het
Ttn T C 2: 76,776,312 (GRCm39) I1577V probably damaging Het
Ubqln3 G A 7: 103,790,674 (GRCm39) P472L probably benign Het
Ugt2b36 C T 5: 87,240,297 (GRCm39) W29* probably null Het
Wdr17 C T 8: 55,113,806 (GRCm39) probably null Het
Zfp790 C A 7: 29,529,514 (GRCm39) S733* probably null Het
Other mutations in Pgap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pgap6 APN 17 26,336,493 (GRCm39) missense probably damaging 0.96
IGL01014:Pgap6 APN 17 26,335,983 (GRCm39) unclassified probably benign
IGL02167:Pgap6 APN 17 26,338,045 (GRCm39) missense probably damaging 1.00
IGL02375:Pgap6 APN 17 26,338,473 (GRCm39) missense probably benign 0.05
IGL02892:Pgap6 APN 17 26,338,094 (GRCm39) missense probably damaging 1.00
IGL02931:Pgap6 APN 17 26,336,923 (GRCm39) missense probably benign
IGL03005:Pgap6 APN 17 26,337,911 (GRCm39) missense probably benign 0.01
IGL03124:Pgap6 APN 17 26,335,808 (GRCm39) missense probably damaging 0.98
IGL03046:Pgap6 UTSW 17 26,338,414 (GRCm39) splice site probably null
R0551:Pgap6 UTSW 17 26,339,576 (GRCm39) missense probably damaging 1.00
R0555:Pgap6 UTSW 17 26,336,088 (GRCm39) missense probably benign 0.19
R1502:Pgap6 UTSW 17 26,339,290 (GRCm39) missense possibly damaging 0.82
R1593:Pgap6 UTSW 17 26,337,381 (GRCm39) missense possibly damaging 0.63
R1688:Pgap6 UTSW 17 26,337,882 (GRCm39) missense possibly damaging 0.94
R1829:Pgap6 UTSW 17 26,341,194 (GRCm39) missense probably damaging 1.00
R2071:Pgap6 UTSW 17 26,341,017 (GRCm39) missense probably damaging 1.00
R2117:Pgap6 UTSW 17 26,336,858 (GRCm39) missense possibly damaging 0.67
R3609:Pgap6 UTSW 17 26,337,860 (GRCm39) missense probably benign 0.23
R3610:Pgap6 UTSW 17 26,337,860 (GRCm39) missense probably benign 0.23
R4564:Pgap6 UTSW 17 26,336,837 (GRCm39) missense possibly damaging 0.80
R4749:Pgap6 UTSW 17 26,335,757 (GRCm39) missense probably damaging 1.00
R4777:Pgap6 UTSW 17 26,340,515 (GRCm39) missense probably damaging 1.00
R4913:Pgap6 UTSW 17 26,339,513 (GRCm39) missense probably damaging 1.00
R5098:Pgap6 UTSW 17 26,337,902 (GRCm39) missense probably damaging 1.00
R5126:Pgap6 UTSW 17 26,340,614 (GRCm39) missense probably damaging 0.99
R5640:Pgap6 UTSW 17 26,337,846 (GRCm39) missense possibly damaging 0.50
R5723:Pgap6 UTSW 17 26,339,536 (GRCm39) frame shift probably null
R5739:Pgap6 UTSW 17 26,339,425 (GRCm39) missense probably damaging 1.00
R5927:Pgap6 UTSW 17 26,340,972 (GRCm39) missense probably benign 0.34
R6587:Pgap6 UTSW 17 26,340,538 (GRCm39) missense probably benign 0.03
R6723:Pgap6 UTSW 17 26,339,610 (GRCm39) missense probably damaging 0.96
R7588:Pgap6 UTSW 17 26,341,017 (GRCm39) missense probably damaging 1.00
R7621:Pgap6 UTSW 17 26,336,865 (GRCm39) missense probably benign 0.00
R7653:Pgap6 UTSW 17 26,339,423 (GRCm39) missense probably damaging 1.00
R7771:Pgap6 UTSW 17 26,341,047 (GRCm39) missense probably damaging 1.00
R8037:Pgap6 UTSW 17 26,336,509 (GRCm39) missense possibly damaging 0.63
R8493:Pgap6 UTSW 17 26,340,931 (GRCm39) missense probably damaging 1.00
R8956:Pgap6 UTSW 17 26,339,374 (GRCm39) missense possibly damaging 0.89
R9048:Pgap6 UTSW 17 26,340,515 (GRCm39) missense probably damaging 1.00
R9574:Pgap6 UTSW 17 26,337,861 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCACGCTCAGCAACCTCATG -3'
(R):5'- CTCTGCCACGTCATGTACTG -3'

Sequencing Primer
(F):5'- AGCAACCTCATGTTCCTGG -3'
(R):5'- CCACGTCATGTACTGTATGTGAG -3'
Posted On 2017-01-03