Mutagenetix > Incidental Mutations

Incidental Mutation 'R5722:Fkbpl'

452294

Institutional Source

Beutler Lab

Gene Symbol

Fkbpl

Ensembl Gene

ENSMUSG00000033739

Gene Name

FK506 binding protein-like

Synonyms

WAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39

MMRRC Submission

043340-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.912) question?

Stock #

R5722 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34644764-34646324 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34645329 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 24 (A24T)

Ref Sequence

ENSEMBL: ENSMUSP00000037273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]

Predicted Effect

probably benign
Transcript: ENSMUST00000015605

SMART Domains

Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	86	110	N/A	INTRINSIC
internal_repeat_1	113	156	2.55e-13	PROSPERO
low complexity region	162	180	N/A	INTRINSIC
internal_repeat_1	186	230	2.55e-13	PROSPERO
low complexity region	238	255	N/A	INTRINSIC
low complexity region	289	301	N/A	INTRINSIC
BRLZ	320	384	7.08e-15	SMART
low complexity region	415	428	N/A	INTRINSIC
low complexity region	484	497	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	667	693	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

Domain	Start	End	E-Value	Type
TPR	208	241	2.92e1	SMART
TPR	250	283	4.77e-2	SMART
TPR	284	317	1.89e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173984

SMART Domains

Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	89	113	N/A	INTRINSIC
internal_repeat_1	116	159	2.54e-13	PROSPERO
low complexity region	165	183	N/A	INTRINSIC
internal_repeat_1	189	233	2.54e-13	PROSPERO
low complexity region	241	258	N/A	INTRINSIC
low complexity region	292	304	N/A	INTRINSIC
BRLZ	323	387	2.9e-17	SMART
low complexity region	418	431	N/A	INTRINSIC
low complexity region	487	500	N/A	INTRINSIC
low complexity region	547	560	N/A	INTRINSIC
low complexity region	670	696	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174519

SMART Domains

Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	23	47	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174600

Predicted Effect

probably benign
Transcript: ENSMUST00000174614

Predicted Effect

probably benign
Transcript: ENSMUST00000174796

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,204,123	T355S	probably benign	Het
4930432K21Rik	A	G	8: 84,171,844	E537G	probably damaging	Het
Actl6a	G	A	3: 32,718,045	R164H	probably damaging	Het
Afg3l2	A	G	18: 67,440,199	Y178H	probably benign	Het
Agtr1a	A	G	13: 30,382,033	*360W	probably null	Het
Arfgef1	A	G	1: 10,138,884	V1830A	probably benign	Het
Asic2	A	T	11: 81,967,980	S69T	probably benign	Het
Axin1	A	T	17: 26,182,557	N368Y	probably damaging	Het
Ces1d	G	A	8: 93,178,128	P328L	probably benign	Het
Cndp2	T	A	18: 84,668,078	K461*	probably null	Het
Cntnap5c	A	T	17: 58,313,857	H977L	probably benign	Het
Glg1	T	C	8: 111,169,562	T177A	possibly damaging	Het
Gm7168	T	C	17: 13,949,562	V397A	probably benign	Het
Hif1a	T	A	12: 73,941,759	D535E	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ice1	T	C	13: 70,615,100	E173G	possibly damaging	Het
Ighmbp2	A	G	19: 3,279,909	V115A	probably damaging	Het
Irf2	A	T	8: 46,818,796	E101D	possibly damaging	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kyat1	C	T	2: 30,188,111	C127Y	probably damaging	Het
Mrgpra4	T	C	7: 47,981,007	H282R	probably benign	Het
Npsr1	C	A	9: 24,313,800	P368Q	probably damaging	Het
Nwd1	G	A	8: 72,675,244	V839M	probably damaging	Het
Olfr430	G	T	1: 174,069,870	D191Y	probably damaging	Het
Olfr644	T	A	7: 104,068,723	M103L	probably damaging	Het
P4ha3	A	G	7: 100,305,991	D351G	probably benign	Het
Pard3b	T	A	1: 62,440,001		probably null	Het
Pik3c2b	G	T	1: 133,103,836	G1505W	probably damaging	Het
Plppr5	A	T	3: 117,621,065	I112L	probably benign	Het
Ptprq	A	G	10: 107,686,365	I575T	possibly damaging	Het
Ranbp3l	A	G	15: 9,000,832	E46G	probably damaging	Het
Rbm46	A	G	3: 82,865,333	V164A	possibly damaging	Het
Sap25	A	G	5: 137,641,451	E13G	probably benign	Het
Setbp1	A	T	18: 78,856,645	V1269E	possibly damaging	Het
Smgc	T	A	15: 91,841,906	S18R	possibly damaging	Het
Snrk	T	C	9: 122,164,006	I345T	probably benign	Het
Sp4	T	A	12: 118,299,241	I357F	possibly damaging	Het
Sra1	A	G	18: 36,674,978	L399P	probably damaging	Het
Stat6	A	G	10: 127,658,373	T658A	probably benign	Het
Sv2a	G	A	3: 96,185,023	R13H	probably benign	Het
Thoc3	G	T	13: 54,460,201	T310N	probably damaging	Het
Tmem8	CGGGG	CGGGGG	17: 26,120,562		probably null	Het
Tox3	A	C	8: 90,347,861		probably null	Het
Trpc6	A	G	9: 8,680,549	E848G	possibly damaging	Het
Ttn	T	A	2: 76,708,246	T34703S	possibly damaging	Het
Ttn	T	C	2: 76,945,968	I1577V	probably damaging	Het
Ubqln3	G	A	7: 104,141,467	P472L	probably benign	Het
Ugt2b36	C	T	5: 87,092,438	W29*	probably null	Het
Wdr17	C	T	8: 54,660,771		probably null	Het
Zfp790	C	A	7: 29,830,089	S733*	probably null	Het

Other mutations in Fkbpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01085:Fkbpl	APN	17	34645744	missense	probably damaging	1.00
IGL02129:Fkbpl	APN	17	34645978	missense	probably damaging	0.99
IGL02322:Fkbpl	APN	17	34645324	missense	probably benign	0.00
IGL03331:Fkbpl	APN	17	34645687	missense	probably damaging	1.00
IGL03347:Fkbpl	APN	17	34646313	unclassified	probably benign
R0278:Fkbpl	UTSW	17	34645410	nonsense	probably null
R0314:Fkbpl	UTSW	17	34646052	missense	possibly damaging	0.62
R0540:Fkbpl	UTSW	17	34645359	missense	probably benign
R0607:Fkbpl	UTSW	17	34645359	missense	probably benign
R1866:Fkbpl	UTSW	17	34645823	missense	possibly damaging	0.50
R4483:Fkbpl	UTSW	17	34646295	missense	probably damaging	1.00
R4746:Fkbpl	UTSW	17	34645329	missense	probably benign
R4795:Fkbpl	UTSW	17	34645329	missense	probably benign
R4796:Fkbpl	UTSW	17	34645329	missense	probably benign
R4839:Fkbpl	UTSW	17	34645865	missense	probably benign
R5268:Fkbpl	UTSW	17	34645329	missense	probably benign
R5290:Fkbpl	UTSW	17	34645329	missense	probably benign
R5357:Fkbpl	UTSW	17	34645329	missense	probably benign
R5358:Fkbpl	UTSW	17	34645329	missense	probably benign
R5359:Fkbpl	UTSW	17	34645329	missense	probably benign
R5360:Fkbpl	UTSW	17	34645329	missense	probably benign
R5361:Fkbpl	UTSW	17	34645329	missense	probably benign
R5363:Fkbpl	UTSW	17	34645329	missense	probably benign
R5406:Fkbpl	UTSW	17	34645329	missense	probably benign
R5435:Fkbpl	UTSW	17	34645329	missense	probably benign
R5533:Fkbpl	UTSW	17	34645329	missense	probably benign
R5535:Fkbpl	UTSW	17	34645329	missense	probably benign
R5723:Fkbpl	UTSW	17	34645329	missense	probably benign
R5760:Fkbpl	UTSW	17	34645329	missense	probably benign
R5861:Fkbpl	UTSW	17	34645329	missense	probably benign
R5941:Fkbpl	UTSW	17	34645329	missense	probably benign
R6109:Fkbpl	UTSW	17	34645329	missense	probably benign
R6124:Fkbpl	UTSW	17	34645329	missense	probably benign
R6146:Fkbpl	UTSW	17	34645329	missense	probably benign
R6148:Fkbpl	UTSW	17	34645329	missense	probably benign
R6185:Fkbpl	UTSW	17	34645329	missense	probably benign
R6186:Fkbpl	UTSW	17	34645329	missense	probably benign
R6186:Fkbpl	UTSW	17	34646179	missense	probably benign	0.12
R6344:Fkbpl	UTSW	17	34645570	missense	probably damaging	1.00
R6481:Fkbpl	UTSW	17	34645414	missense	possibly damaging	0.95
R6564:Fkbpl	UTSW	17	34646266	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- CGAGGAGTCTTAACTAGGAATTCTG -3'
(R):5'- GTGCTCTGCCATCTCATTGG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'

Posted On

2017-01-03