Incidental Mutation 'R5722:Fkbpl'
ID452294
Institutional Source Beutler Lab
Gene Symbol Fkbpl
Ensembl Gene ENSMUSG00000033739
Gene NameFK506 binding protein-like
SynonymsWAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34644764-34646324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34645329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 24 (A24T)
Ref Sequence ENSEMBL: ENSMUSP00000037273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]
Predicted Effect probably benign
Transcript: ENSMUST00000015605
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

DomainStartEndE-ValueType
TPR 208 241 2.92e1 SMART
TPR 250 283 4.77e-2 SMART
TPR 284 317 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173984
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174600
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Predicted Effect probably benign
Transcript: ENSMUST00000174796
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Fkbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Fkbpl APN 17 34645744 missense probably damaging 1.00
IGL02129:Fkbpl APN 17 34645978 missense probably damaging 0.99
IGL02322:Fkbpl APN 17 34645324 missense probably benign 0.00
IGL03331:Fkbpl APN 17 34645687 missense probably damaging 1.00
IGL03347:Fkbpl APN 17 34646313 unclassified probably benign
R0278:Fkbpl UTSW 17 34645410 nonsense probably null
R0314:Fkbpl UTSW 17 34646052 missense possibly damaging 0.62
R0540:Fkbpl UTSW 17 34645359 missense probably benign
R0607:Fkbpl UTSW 17 34645359 missense probably benign
R1866:Fkbpl UTSW 17 34645823 missense possibly damaging 0.50
R4483:Fkbpl UTSW 17 34646295 missense probably damaging 1.00
R4746:Fkbpl UTSW 17 34645329 missense probably benign
R4795:Fkbpl UTSW 17 34645329 missense probably benign
R4796:Fkbpl UTSW 17 34645329 missense probably benign
R4839:Fkbpl UTSW 17 34645865 missense probably benign
R5268:Fkbpl UTSW 17 34645329 missense probably benign
R5290:Fkbpl UTSW 17 34645329 missense probably benign
R5357:Fkbpl UTSW 17 34645329 missense probably benign
R5358:Fkbpl UTSW 17 34645329 missense probably benign
R5359:Fkbpl UTSW 17 34645329 missense probably benign
R5360:Fkbpl UTSW 17 34645329 missense probably benign
R5361:Fkbpl UTSW 17 34645329 missense probably benign
R5363:Fkbpl UTSW 17 34645329 missense probably benign
R5406:Fkbpl UTSW 17 34645329 missense probably benign
R5435:Fkbpl UTSW 17 34645329 missense probably benign
R5533:Fkbpl UTSW 17 34645329 missense probably benign
R5535:Fkbpl UTSW 17 34645329 missense probably benign
R5723:Fkbpl UTSW 17 34645329 missense probably benign
R5760:Fkbpl UTSW 17 34645329 missense probably benign
R5861:Fkbpl UTSW 17 34645329 missense probably benign
R5941:Fkbpl UTSW 17 34645329 missense probably benign
R6109:Fkbpl UTSW 17 34645329 missense probably benign
R6124:Fkbpl UTSW 17 34645329 missense probably benign
R6146:Fkbpl UTSW 17 34645329 missense probably benign
R6148:Fkbpl UTSW 17 34645329 missense probably benign
R6185:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34646179 missense probably benign 0.12
R6344:Fkbpl UTSW 17 34645570 missense probably damaging 1.00
R6481:Fkbpl UTSW 17 34645414 missense possibly damaging 0.95
R6564:Fkbpl UTSW 17 34646266 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CGAGGAGTCTTAACTAGGAATTCTG -3'
(R):5'- GTGCTCTGCCATCTCATTGG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'
Posted On2017-01-03