Incidental Mutation 'R5722:Sra1'
List |< first << previous [record 39 of 51] next >> last >|
ID452296
Institutional Source Beutler Lab
Gene Symbol Sra1
Ensembl Gene ENSMUSG00000006050
Gene Namesteroid receptor RNA activator 1
SynonymsSrap
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36666681-36679366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36674978 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 399 (L399P)
Ref Sequence ENSEMBL: ENSMUSP00000001415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036158] [ENSMUST00000050476] [ENSMUST00000173875] [ENSMUST00000185899] [ENSMUST00000186538]
Predicted Effect probably damaging
Transcript: ENSMUST00000001415
AA Change: L399P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050
AA Change: L399P

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000006209
SMART Domains Protein: ENSMUSP00000006209
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
Pfam:SRA1 65 208 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036158
SMART Domains Protein: ENSMUSP00000036081
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 36 321 6.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050476
SMART Domains Protein: ENSMUSP00000129718
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173202
Predicted Effect probably benign
Transcript: ENSMUST00000173482
Predicted Effect probably benign
Transcript: ENSMUST00000173875
SMART Domains Protein: ENSMUSP00000133360
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
Pfam:SRA1 72 217 1.1e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174125
Predicted Effect probably benign
Transcript: ENSMUST00000185899
SMART Domains Protein: ENSMUSP00000140201
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF4535 63 101 3.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186538
SMART Domains Protein: ENSMUSP00000140615
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice are protected against diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Sra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Sra1 APN 18 36668739 missense probably benign 0.36
IGL01390:Sra1 APN 18 36670081 missense probably damaging 1.00
IGL01645:Sra1 APN 18 36671473 missense probably damaging 1.00
IGL02478:Sra1 APN 18 36668792 missense probably benign 0.00
IGL02578:Sra1 APN 18 36670097 nonsense probably null
R0218:Sra1 UTSW 18 36676609 unclassified probably benign
R0243:Sra1 UTSW 18 36675706 nonsense probably null
R0432:Sra1 UTSW 18 36677503 missense probably benign
R0834:Sra1 UTSW 18 36668776 missense probably benign 0.00
R1886:Sra1 UTSW 18 36668777 missense probably benign
R2105:Sra1 UTSW 18 36675068 missense probably benign 0.00
R2911:Sra1 UTSW 18 36676185 missense possibly damaging 0.49
R4951:Sra1 UTSW 18 36676441 nonsense probably null
R5034:Sra1 UTSW 18 36678995 critical splice donor site probably null
R5091:Sra1 UTSW 18 36669959 intron probably benign
R5122:Sra1 UTSW 18 36667594 missense probably benign 0.03
R5656:Sra1 UTSW 18 36678407 missense probably damaging 0.99
R5726:Sra1 UTSW 18 36670173 intron probably benign
R5729:Sra1 UTSW 18 36667443 utr 3 prime probably benign
R5937:Sra1 UTSW 18 36671599 unclassified probably null
R6145:Sra1 UTSW 18 36667575 missense probably damaging 1.00
R6161:Sra1 UTSW 18 36670283 missense probably damaging 0.99
R7423:Sra1 UTSW 18 36667483 missense probably benign 0.00
R8074:Sra1 UTSW 18 36675011 missense possibly damaging 0.89
R8100:Sra1 UTSW 18 36676895 missense probably damaging 1.00
Z1176:Sra1 UTSW 18 36670009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAATGCCCTAAACTTCAAATG -3'
(R):5'- CTTTATGTGGGCAGGCAGAG -3'

Sequencing Primer
(F):5'- ACAGCGTTAAAAAGTCAGATGTG -3'
(R):5'- GGCAGAGGCTGGTGCAG -3'
Posted On2017-01-03