Mutagenetix > Incidental Mutation

Incidental Mutation 'R5722:Afg3l2'

452297

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

043340-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5722 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67440199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 178 (Y178H)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000025408
AA Change: Y178H

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: Y178H

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,204,123	T355S	probably benign	Het
4930432K21Rik	A	G	8: 84,171,844	E537G	probably damaging	Het
Actl6a	G	A	3: 32,718,045	R164H	probably damaging	Het
Agtr1a	A	G	13: 30,382,033	*360W	probably null	Het
Arfgef1	A	G	1: 10,138,884	V1830A	probably benign	Het
Asic2	A	T	11: 81,967,980	S69T	probably benign	Het
Axin1	A	T	17: 26,182,557	N368Y	probably damaging	Het
Ces1d	G	A	8: 93,178,128	P328L	probably benign	Het
Cndp2	T	A	18: 84,668,078	K461*	probably null	Het
Cntnap5c	A	T	17: 58,313,857	H977L	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Glg1	T	C	8: 111,169,562	T177A	possibly damaging	Het
Gm7168	T	C	17: 13,949,562	V397A	probably benign	Het
Hif1a	T	A	12: 73,941,759	D535E	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ice1	T	C	13: 70,615,100	E173G	possibly damaging	Het
Ighmbp2	A	G	19: 3,279,909	V115A	probably damaging	Het
Irf2	A	T	8: 46,818,796	E101D	possibly damaging	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kyat1	C	T	2: 30,188,111	C127Y	probably damaging	Het
Mrgpra4	T	C	7: 47,981,007	H282R	probably benign	Het
Npsr1	C	A	9: 24,313,800	P368Q	probably damaging	Het
Nwd1	G	A	8: 72,675,244	V839M	probably damaging	Het
Olfr430	G	T	1: 174,069,870	D191Y	probably damaging	Het
Olfr644	T	A	7: 104,068,723	M103L	probably damaging	Het
P4ha3	A	G	7: 100,305,991	D351G	probably benign	Het
Pard3b	T	A	1: 62,440,001		probably null	Het
Pik3c2b	G	T	1: 133,103,836	G1505W	probably damaging	Het
Plppr5	A	T	3: 117,621,065	I112L	probably benign	Het
Ptprq	A	G	10: 107,686,365	I575T	possibly damaging	Het
Ranbp3l	A	G	15: 9,000,832	E46G	probably damaging	Het
Rbm46	A	G	3: 82,865,333	V164A	possibly damaging	Het
Sap25	A	G	5: 137,641,451	E13G	probably benign	Het
Setbp1	A	T	18: 78,856,645	V1269E	possibly damaging	Het
Smgc	T	A	15: 91,841,906	S18R	possibly damaging	Het
Snrk	T	C	9: 122,164,006	I345T	probably benign	Het
Sp4	T	A	12: 118,299,241	I357F	possibly damaging	Het
Sra1	A	G	18: 36,674,978	L399P	probably damaging	Het
Stat6	A	G	10: 127,658,373	T658A	probably benign	Het
Sv2a	G	A	3: 96,185,023	R13H	probably benign	Het
Thoc3	G	T	13: 54,460,201	T310N	probably damaging	Het
Tmem8	CGGGG	CGGGGG	17: 26,120,562		probably null	Het
Tox3	A	C	8: 90,347,861		probably null	Het
Trpc6	A	G	9: 8,680,549	E848G	possibly damaging	Het
Ttn	T	A	2: 76,708,246	T34703S	possibly damaging	Het
Ttn	T	C	2: 76,945,968	I1577V	probably damaging	Het
Ubqln3	G	A	7: 104,141,467	P472L	probably benign	Het
Ugt2b36	C	T	5: 87,092,438	W29*	probably null	Het
Wdr17	C	T	8: 54,660,771		probably null	Het
Zfp790	C	A	7: 29,830,089	S733*	probably null	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TCCACAAAGCTGTCTCGTGG -3'
(R):5'- GCCCACATAGCACAGATCATATTTC -3'

Sequencing Primer
(F):5'- AAAGCTGTCTCGTGGTCCCC -3'
(R):5'- TAGCACAGATCATATTTCCACACAG -3'

Posted On

2017-01-03