Incidental Mutation 'R5722:Setbp1'
ID452298
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78856645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1269 (V1269E)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025430
AA Change: V1269E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: V1269E

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161465
AA Change: V1269E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: V1269E

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7840:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
R7923:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7932:Setbp1 UTSW 18 78856853 missense probably benign 0.00
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTTCAGACTGCAAAGGCC -3'
(R):5'- CCAAGAACAACTTTGAGGTGG -3'

Sequencing Primer
(F):5'- CTGGCAAGTCCAAGTCTAGAG -3'
(R):5'- TGGACACCCTGTCTACGCTG -3'
Posted On2017-01-03