Incidental Mutation 'R5722:Cndp2'
List |< first << previous [record 10 of 51] next >> last >|
ID452299
Institutional Source Beutler Lab
Gene Symbol Cndp2
Ensembl Gene ENSMUSG00000024644
Gene NameCNDP dipeptidase 2 (metallopeptidase M20 family)
SynonymsPep1, Dip-2, 0610010E05Rik, Cn2, Pep-1
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location84667470-84685633 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 84668078 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 461 (K461*)
Ref Sequence ENSEMBL: ENSMUSP00000128696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025546] [ENSMUST00000168419]
Predicted Effect probably null
Transcript: ENSMUST00000025546
AA Change: K461*
SMART Domains Protein: ENSMUSP00000025546
Gene: ENSMUSG00000024644
AA Change: K461*

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.8e-35 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168419
AA Change: K461*
SMART Domains Protein: ENSMUSP00000128696
Gene: ENSMUSG00000024644
AA Change: K461*

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.2e-33 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Cndp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Cndp2 APN 18 84677376 missense probably damaging 1.00
IGL01143:Cndp2 APN 18 84677317 critical splice donor site probably null
IGL01310:Cndp2 APN 18 84670877 missense possibly damaging 0.95
IGL01408:Cndp2 APN 18 84670911 missense probably benign
IGL01520:Cndp2 APN 18 84668607 missense probably benign 0.03
IGL02095:Cndp2 APN 18 84681032 missense possibly damaging 0.67
R1108:Cndp2 UTSW 18 84675060 missense probably damaging 1.00
R1264:Cndp2 UTSW 18 84678791 missense possibly damaging 0.88
R1466:Cndp2 UTSW 18 84677315 splice site probably benign
R1584:Cndp2 UTSW 18 84677315 splice site probably benign
R2363:Cndp2 UTSW 18 84668569 missense probably damaging 0.96
R2383:Cndp2 UTSW 18 84675090 missense possibly damaging 0.82
R3153:Cndp2 UTSW 18 84668597 missense probably benign 0.02
R4590:Cndp2 UTSW 18 84669808 missense probably damaging 1.00
R4788:Cndp2 UTSW 18 84675164 missense probably damaging 1.00
R5033:Cndp2 UTSW 18 84670829 missense possibly damaging 0.94
R5154:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R5178:Cndp2 UTSW 18 84675028 missense probably benign 0.00
R5326:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5542:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5556:Cndp2 UTSW 18 84672124 missense probably benign 0.38
R6431:Cndp2 UTSW 18 84675078 nonsense probably null
R6682:Cndp2 UTSW 18 84677330 missense probably benign 0.00
R7036:Cndp2 UTSW 18 84669945 missense possibly damaging 0.94
R7728:Cndp2 UTSW 18 84672077 missense probably benign 0.00
R7806:Cndp2 UTSW 18 84670820 missense probably benign
R8018:Cndp2 UTSW 18 84668602 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCTGGAGGCAATGTCTC -3'
(R):5'- CTCTTCTTGAGAACCATCAGGC -3'

Sequencing Primer
(F):5'- GAGGCAATGTCTCCATTCTTGC -3'
(R):5'- GAACCATCAGGCTGAATTATAAAGTC -3'
Posted On2017-01-03