Incidental Mutation 'R0552:Akr1b10'
ID45230
Institutional Source Beutler Lab
Gene Symbol Akr1b10
Ensembl Gene ENSMUSG00000061758
Gene Namealdo-keto reductase family 1, member B10 (aldose reductase)
Synonyms2310005E10Rik
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34384218-34396950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34392985 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 216 (T216A)
Ref Sequence ENSEMBL: ENSMUSP00000110703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038383] [ENSMUST00000115051] [ENSMUST00000139156]
Predicted Effect probably benign
Transcript: ENSMUST00000038383
AA Change: T244A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039114
Gene: ENSMUSG00000061758
AA Change: T244A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 294 2.1e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115051
AA Change: T216A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110703
Gene: ENSMUSG00000061758
AA Change: T216A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 266 2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139156
SMART Domains Protein: ENSMUSP00000138639
Gene: ENSMUSG00000061758

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 128 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182055
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Akr1b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Akr1b10 APN 6 34388902 splice site probably benign
IGL00840:Akr1b10 APN 6 34394106 missense possibly damaging 0.61
IGL01906:Akr1b10 APN 6 34387811 missense probably benign
R0732:Akr1b10 UTSW 6 34390109 missense probably benign
R1371:Akr1b10 UTSW 6 34392459 missense probably benign 0.28
R1895:Akr1b10 UTSW 6 34388870 missense probably damaging 1.00
R3704:Akr1b10 UTSW 6 34394754 missense probably damaging 0.98
R3704:Akr1b10 UTSW 6 34394755 missense probably benign 0.00
R3975:Akr1b10 UTSW 6 34392496 critical splice donor site probably null
R4020:Akr1b10 UTSW 6 34392453 missense probably benign 0.42
R4573:Akr1b10 UTSW 6 34392129 missense probably damaging 1.00
R5062:Akr1b10 UTSW 6 34392106 missense probably damaging 1.00
R5540:Akr1b10 UTSW 6 34394112 missense probably damaging 1.00
R6012:Akr1b10 UTSW 6 34387780 missense probably damaging 1.00
R6021:Akr1b10 UTSW 6 34392374 splice site probably null
R6256:Akr1b10 UTSW 6 34387688 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGTGCTTAGCCTTGATGATG -3'
(R):5'- TGCTTGGGAGTCCAACAGACTTAGA -3'

Sequencing Primer
(F):5'- CCTTGATGATGTCCTGGCAG -3'
(R):5'- atgggaagtagagaggaggg -3'
Posted On2013-06-11