Incidental Mutation 'R5723:Abcg2'
List |< first << previous [record 2 of 53] next >> last >|
ID452316
Institutional Source Beutler Lab
Gene Symbol Abcg2
Ensembl Gene ENSMUSG00000029802
Gene NameATP binding cassette subfamily G member 2 (Junior blood group)
SynonymsBcrp
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58584523-58695676 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 58678351 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 109 (Q109*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031822] [ENSMUST00000114294] [ENSMUST00000143752] [ENSMUST00000203146]
Predicted Effect probably null
Transcript: ENSMUST00000031822
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000031822
Gene: ENSMUSG00000029802
AA Change: Q424*

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 5.4e-42 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114294
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000109933
Gene: ENSMUSG00000029802
AA Change: Q424*

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 1.2e-40 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134426
Predicted Effect probably null
Transcript: ENSMUST00000143752
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000138608
Gene: ENSMUSG00000029802
AA Change: Q424*

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 573 7.2e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145685
AA Change: Q109*
Predicted Effect probably benign
Transcript: ENSMUST00000203146
SMART Domains Protein: ENSMUSP00000145435
Gene: ENSMUSG00000029802

DomainStartEndE-ValueType
SCOP:d1jj7a_ 33 129 7e-8 SMART
Blast:AAA 71 125 3e-32 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, the human protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. This protein likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit extreme sensitivity to the dietary chlorophyll-catabolite pheophorbide a, resulting in severe phototoxic skin lesions upon light exposure. Mutants show a novel form of protoporphyria, associated with a 10-fold increase in erythrocyte levels of protoporphyrin IX. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Abcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01489:Abcg2 APN 6 58685823 critical splice donor site probably null
IGL01654:Abcg2 APN 6 58683321 critical splice donor site probably null
IGL02646:Abcg2 APN 6 58685696 missense probably benign 0.01
IGL03342:Abcg2 APN 6 58665135 missense probably damaging 1.00
PIT4519001:Abcg2 UTSW 6 58674807 missense probably damaging 0.99
R0092:Abcg2 UTSW 6 58685777 missense probably benign 0.14
R0313:Abcg2 UTSW 6 58672097 missense probably benign
R0742:Abcg2 UTSW 6 58678326 missense probably benign 0.00
R1165:Abcg2 UTSW 6 58678300 missense probably benign 0.21
R1302:Abcg2 UTSW 6 58685817 missense probably damaging 1.00
R1476:Abcg2 UTSW 6 58678337 missense probably benign 0.06
R1523:Abcg2 UTSW 6 58685694 missense possibly damaging 0.96
R2056:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2057:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2153:Abcg2 UTSW 6 58684322 splice site probably null
R5636:Abcg2 UTSW 6 58672056 missense probably damaging 0.98
R5972:Abcg2 UTSW 6 58672085 missense probably benign 0.00
R6319:Abcg2 UTSW 6 58674738 missense probably benign 0.03
R6896:Abcg2 UTSW 6 58683313 missense probably damaging 1.00
R7136:Abcg2 UTSW 6 58684340 missense possibly damaging 0.67
R7387:Abcg2 UTSW 6 58689624 missense possibly damaging 0.67
X0028:Abcg2 UTSW 6 58678276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGAACCAATTGTAACCTACTG -3'
(R):5'- TGCCAGTTTTCAAGTTCCGAC -3'

Sequencing Primer
(F):5'- ACCTCTAATGGACATTCTTTCT -3'
(R):5'- AAAGACTTGCCTTGGCCATG -3'
Posted On2017-01-03